Incidental Mutation 'R5152:Coch'
ID395461
Institutional Source Beutler Lab
Gene Symbol Coch
Ensembl Gene ENSMUSG00000020953
Gene Namecochlin
SynonymsCoch-5B2, D12H14S564E
MMRRC Submission 042734-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5152 (G1)
Quality Score158
Status Validated
Chromosome12
Chromosomal Location51593341-51605771 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51595442 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 66 (N66D)
Ref Sequence ENSEMBL: ENSMUSP00000128127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085412] [ENSMUST00000164782]
Predicted Effect probably benign
Transcript: ENSMUST00000085412
AA Change: N66D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000082533
Gene: ENSMUSG00000020953
AA Change: N66D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164782
AA Change: N66D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128127
Gene: ENSMUSG00000020953
AA Change: N66D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220173
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly conserved in human, mouse, and chicken, showing 94% and 79% amino acid identity of human to mouse and chicken sequences, respectively. Hybridization to this gene was detected in spindle-shaped cells located along nerve fibers between the auditory ganglion and sensory epithelium. These cells accompany neurites at the habenula perforata, the opening through which neurites extend to innervate hair cells. This and the pattern of expression of this gene in chicken inner ear paralleled the histologic findings of acidophilic deposits, consistent with mucopolysaccharide ground substance, in temporal bones from DFNA9 (autosomal dominant nonsyndromic sensorineural deafness 9) patients. Mutations that cause DFNA9 have been reported in this gene. Alternative splicing results in multiple transcript variants encoding the same protein. Additional splice variants encoding distinct isoforms have been described but their biological validities have not been demonstrated. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a point mutation have vestibular and hearing dysfunctions that worsen with age. Homozyogtes for a null allele have no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,540,623 S1503P probably benign Het
Actn3 C A 19: 4,863,544 V620F probably damaging Het
Adamtsl3 A G 7: 82,574,544 K252E probably benign Het
Adgrg1 A G 8: 95,009,745 Y509C probably damaging Het
Arhgef2 G A 3: 88,629,568 probably null Het
Bod1l T C 5: 41,816,543 E2476G probably benign Het
C130026I21Rik G A 1: 85,261,860 P19S probably benign Het
Capn3 T C 2: 120,501,330 probably benign Het
Catsperz T C 19: 6,923,337 T147A probably benign Het
Cc2d1b C A 4: 108,626,086 A289E probably benign Het
Ccdc170 A C 10: 4,561,107 H722P probably damaging Het
Cdk13 C A 13: 17,718,525 A1358S probably benign Het
Cntn6 T A 6: 104,569,113 probably benign Het
Col12a1 A G 9: 79,656,748 S1732P probably damaging Het
Copa T A 1: 172,118,061 V917E probably benign Het
Csmd2 C A 4: 128,552,035 N3299K probably benign Het
Cyp2c67 A T 19: 39,638,688 F233I probably benign Het
D630039A03Rik T A 4: 57,910,434 H126L probably damaging Het
Ddx46 T C 13: 55,659,030 L492P probably damaging Het
Dpysl3 C T 18: 43,438,080 G43D probably benign Het
Enpp5 C T 17: 44,081,133 P151L probably damaging Het
Exoc3l4 T C 12: 111,430,893 probably benign Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Flg2 C A 3: 93,214,977 P1485T unknown Het
Fmo5 A G 3: 97,641,762 Y242C probably benign Het
Fsip2 C A 2: 82,978,572 T1745N probably benign Het
Gata4 T A 14: 63,241,121 N10Y probably damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm4787 A C 12: 81,378,677 S236A probably benign Het
Gm9125 T C 3: 94,050,144 probably benign Het
Golga7 A C 8: 23,245,949 S94A probably benign Het
Gpbp1 A G 13: 111,453,281 probably benign Het
Grm1 A G 10: 11,079,875 Y222H probably benign Het
Gstcd A G 3: 133,084,956 Y17H possibly damaging Het
Hephl1 C A 9: 15,080,185 D586Y probably damaging Het
Hpn C A 7: 31,099,836 V35L probably damaging Het
Il23r T A 6: 67,423,741 N535I probably damaging Het
Inpp4a T C 1: 37,358,535 I45T possibly damaging Het
Itgae G C 11: 73,130,995 G901R probably damaging Het
Kif28 T C 1: 179,702,538 D686G probably damaging Het
Kit A G 5: 75,620,847 E312G probably benign Het
Lamb2 C A 9: 108,487,738 S1230R probably benign Het
Lars A T 18: 42,228,777 D588E possibly damaging Het
Lgr4 T A 2: 110,000,603 F292I probably damaging Het
Lmf1 C T 17: 25,655,519 S458L probably damaging Het
Lpin2 T A 17: 71,245,159 C787S probably damaging Het
Ms4a4a A C 19: 11,388,312 I138L probably benign Het
Mterf1a A T 5: 3,890,984 F295I probably damaging Het
Muc4 A T 16: 32,757,058 K241* probably null Het
Muc5b T C 7: 141,865,531 F4017S possibly damaging Het
Nfkbil1 T C 17: 35,221,408 probably benign Het
Olfr1269 A G 2: 90,119,121 L159P probably damaging Het
Olfr935 A T 9: 38,995,177 V86E possibly damaging Het
Olfr976 T C 9: 39,956,906 T22A probably benign Het
Osgep T C 14: 50,917,858 D81G probably damaging Het
Otos A G 1: 92,644,394 F70S probably damaging Het
Pcdhb2 T A 18: 37,296,126 V384D probably damaging Het
Ppp1r10 C T 17: 35,929,252 P514S probably damaging Het
Pramef17 G A 4: 143,994,260 P37L probably damaging Het
Prdm16 A G 4: 154,346,102 Y309H probably damaging Het
Rap1gds1 A T 3: 138,956,201 D382E probably damaging Het
Reln A G 5: 21,948,629 F2226L probably damaging Het
Rmi2 C T 16: 10,839,901 T125M probably damaging Het
Setd1a C T 7: 127,784,025 T231I probably benign Het
Sftpa1 G A 14: 41,134,352 G218D probably damaging Het
Shcbp1 A T 8: 4,736,138 F655I probably damaging Het
Slc5a7 T C 17: 54,278,833 I319V possibly damaging Het
Spata31d1c C T 13: 65,035,595 T317I probably damaging Het
Speg C T 1: 75,428,098 P2845S possibly damaging Het
Synpo2 A G 3: 123,235,901 probably null Het
Tdrd7 T A 4: 46,013,191 S644T probably damaging Het
Tmem182 T A 1: 40,838,300 Y112N probably damaging Het
Usp45 T A 4: 21,824,815 N522K probably benign Het
Vnn3 A T 10: 23,864,339 Y180F probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn1 A T 9: 95,964,065 D57V probably benign Het
Zfp831 T C 2: 174,644,564 V344A probably benign Het
Other mutations in Coch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Coch APN 12 51603353 missense probably damaging 1.00
IGL01803:Coch APN 12 51603299 missense probably benign 0.15
IGL02613:Coch APN 12 51595349 missense possibly damaging 0.76
IGL02697:Coch APN 12 51597038 missense probably benign 0.00
IGL03351:Coch APN 12 51603206 missense probably benign 0.05
R0732:Coch UTSW 12 51595372 missense probably damaging 1.00
R1485:Coch UTSW 12 51598289 missense probably damaging 1.00
R1757:Coch UTSW 12 51602848 missense probably damaging 1.00
R2073:Coch UTSW 12 51602689 missense probably benign 0.00
R2231:Coch UTSW 12 51602865 missense probably benign
R2440:Coch UTSW 12 51596562 missense probably damaging 0.99
R3104:Coch UTSW 12 51603421 missense probably benign
R3623:Coch UTSW 12 51602826 missense probably benign 0.06
R3624:Coch UTSW 12 51602826 missense probably benign 0.06
R3932:Coch UTSW 12 51603338 missense probably damaging 1.00
R3933:Coch UTSW 12 51603338 missense probably damaging 1.00
R3945:Coch UTSW 12 51601812 critical splice acceptor site probably null
R3946:Coch UTSW 12 51601812 critical splice acceptor site probably null
R4423:Coch UTSW 12 51598149 splice site probably null
R4660:Coch UTSW 12 51595485 missense probably benign 0.21
R4732:Coch UTSW 12 51605019 missense probably benign 0.28
R4733:Coch UTSW 12 51605019 missense probably benign 0.28
R4844:Coch UTSW 12 51602694 missense probably damaging 0.98
R4997:Coch UTSW 12 51603181 splice site probably null
R5173:Coch UTSW 12 51596507 nonsense probably null
R6134:Coch UTSW 12 51602753 missense probably damaging 1.00
R6481:Coch UTSW 12 51598173 missense probably damaging 1.00
R6497:Coch UTSW 12 51602721 missense probably benign 0.06
R6714:Coch UTSW 12 51602737 missense probably damaging 1.00
R6896:Coch UTSW 12 51602869 missense possibly damaging 0.62
R7242:Coch UTSW 12 51593561 start gained probably benign
R7463:Coch UTSW 12 51593625 start codon destroyed probably null 0.02
Predicted Primers PCR Primer
(F):5'- TAGAATCCCTGCAATACTTCCC -3'
(R):5'- TGCACATTAGGTCATGCAGG -3'

Sequencing Primer
(F):5'- TGCAATACTTCCCCCGTAAAG -3'
(R):5'- CATTAGGTCATGCAGGAATACTCACG -3'
Posted On2016-06-21