Incidental Mutation 'R5152:Nfkbil1'
ID395474
Institutional Source Beutler Lab
Gene Symbol Nfkbil1
Ensembl Gene ENSMUSG00000042419
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor like 1
SynonymsDef-7
MMRRC Submission 042734-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5152 (G1)
Quality Score185
Status Validated
Chromosome17
Chromosomal Location35220175-35235792 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 35221408 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048994] [ENSMUST00000118793]
Predicted Effect probably benign
Transcript: ENSMUST00000048994
SMART Domains Protein: ENSMUSP00000035452
Gene: ENSMUSG00000042419

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
ANK 65 94 1.01e2 SMART
ANK 98 131 3.81e2 SMART
low complexity region 153 165 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176748
SMART Domains Protein: ENSMUSP00000134846
Gene: ENSMUSG00000042419

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a divergent member of the I-kappa-B family of proteins. Its function has not been determined. The gene lies within the major histocompatibility complex (MHC) class I region on chromosome 6. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,540,623 S1503P probably benign Het
Actn3 C A 19: 4,863,544 V620F probably damaging Het
Adamtsl3 A G 7: 82,574,544 K252E probably benign Het
Adgrg1 A G 8: 95,009,745 Y509C probably damaging Het
Arhgef2 G A 3: 88,629,568 probably null Het
Bod1l T C 5: 41,816,543 E2476G probably benign Het
C130026I21Rik G A 1: 85,261,860 P19S probably benign Het
Capn3 T C 2: 120,501,330 probably benign Het
Catsperz T C 19: 6,923,337 T147A probably benign Het
Cc2d1b C A 4: 108,626,086 A289E probably benign Het
Ccdc170 A C 10: 4,561,107 H722P probably damaging Het
Cdk13 C A 13: 17,718,525 A1358S probably benign Het
Cntn6 T A 6: 104,569,113 probably benign Het
Coch A G 12: 51,595,442 N66D probably benign Het
Col12a1 A G 9: 79,656,748 S1732P probably damaging Het
Copa T A 1: 172,118,061 V917E probably benign Het
Csmd2 C A 4: 128,552,035 N3299K probably benign Het
Cyp2c67 A T 19: 39,638,688 F233I probably benign Het
D630039A03Rik T A 4: 57,910,434 H126L probably damaging Het
Ddx46 T C 13: 55,659,030 L492P probably damaging Het
Dpysl3 C T 18: 43,438,080 G43D probably benign Het
Enpp5 C T 17: 44,081,133 P151L probably damaging Het
Exoc3l4 T C 12: 111,430,893 probably benign Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Flg2 C A 3: 93,214,977 P1485T unknown Het
Fmo5 A G 3: 97,641,762 Y242C probably benign Het
Fsip2 C A 2: 82,978,572 T1745N probably benign Het
Gata4 T A 14: 63,241,121 N10Y probably damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm4787 A C 12: 81,378,677 S236A probably benign Het
Gm9125 T C 3: 94,050,144 probably benign Het
Golga7 A C 8: 23,245,949 S94A probably benign Het
Gpbp1 A G 13: 111,453,281 probably benign Het
Grm1 A G 10: 11,079,875 Y222H probably benign Het
Gstcd A G 3: 133,084,956 Y17H possibly damaging Het
Hephl1 C A 9: 15,080,185 D586Y probably damaging Het
Hpn C A 7: 31,099,836 V35L probably damaging Het
Il23r T A 6: 67,423,741 N535I probably damaging Het
Inpp4a T C 1: 37,358,535 I45T possibly damaging Het
Itgae G C 11: 73,130,995 G901R probably damaging Het
Kif28 T C 1: 179,702,538 D686G probably damaging Het
Kit A G 5: 75,620,847 E312G probably benign Het
Lamb2 C A 9: 108,487,738 S1230R probably benign Het
Lars A T 18: 42,228,777 D588E possibly damaging Het
Lgr4 T A 2: 110,000,603 F292I probably damaging Het
Lmf1 C T 17: 25,655,519 S458L probably damaging Het
Lpin2 T A 17: 71,245,159 C787S probably damaging Het
Ms4a4a A C 19: 11,388,312 I138L probably benign Het
Mterf1a A T 5: 3,890,984 F295I probably damaging Het
Muc4 A T 16: 32,757,058 K241* probably null Het
Muc5b T C 7: 141,865,531 F4017S possibly damaging Het
Olfr1269 A G 2: 90,119,121 L159P probably damaging Het
Olfr935 A T 9: 38,995,177 V86E possibly damaging Het
Olfr976 T C 9: 39,956,906 T22A probably benign Het
Osgep T C 14: 50,917,858 D81G probably damaging Het
Otos A G 1: 92,644,394 F70S probably damaging Het
Pcdhb2 T A 18: 37,296,126 V384D probably damaging Het
Ppp1r10 C T 17: 35,929,252 P514S probably damaging Het
Pramef17 G A 4: 143,994,260 P37L probably damaging Het
Prdm16 A G 4: 154,346,102 Y309H probably damaging Het
Rap1gds1 A T 3: 138,956,201 D382E probably damaging Het
Reln A G 5: 21,948,629 F2226L probably damaging Het
Rmi2 C T 16: 10,839,901 T125M probably damaging Het
Setd1a C T 7: 127,784,025 T231I probably benign Het
Sftpa1 G A 14: 41,134,352 G218D probably damaging Het
Shcbp1 A T 8: 4,736,138 F655I probably damaging Het
Slc5a7 T C 17: 54,278,833 I319V possibly damaging Het
Spata31d1c C T 13: 65,035,595 T317I probably damaging Het
Speg C T 1: 75,428,098 P2845S possibly damaging Het
Synpo2 A G 3: 123,235,901 probably null Het
Tdrd7 T A 4: 46,013,191 S644T probably damaging Het
Tmem182 T A 1: 40,838,300 Y112N probably damaging Het
Usp45 T A 4: 21,824,815 N522K probably benign Het
Vnn3 A T 10: 23,864,339 Y180F probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn1 A T 9: 95,964,065 D57V probably benign Het
Zfp831 T C 2: 174,644,564 V344A probably benign Het
Other mutations in Nfkbil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02041:Nfkbil1 APN 17 35220958 missense probably benign 0.14
IGL02220:Nfkbil1 APN 17 35220746 missense possibly damaging 0.63
IGL02661:Nfkbil1 APN 17 35220671 missense probably benign
IGL03347:Nfkbil1 APN 17 35220583 missense probably damaging 0.99
R1630:Nfkbil1 UTSW 17 35221164 missense probably damaging 1.00
R3930:Nfkbil1 UTSW 17 35220956 missense probably benign 0.08
R4115:Nfkbil1 UTSW 17 35221310 missense probably damaging 1.00
R5995:Nfkbil1 UTSW 17 35220798 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCTTCGGCAGAATCCCAGGG -3'
(R):5'- GCAGAACACAGTGTTTTGATATTC -3'

Sequencing Primer
(F):5'- GGAGTCTCCCCATCCTTAT -3'
(R):5'- CCTCCTGAGCACTGGAATTAAAGTG -3'
Posted On2016-06-21