Incidental Mutation 'R5153:Siglec1'
ID395496
Institutional Source Beutler Lab
Gene Symbol Siglec1
Ensembl Gene ENSMUSG00000027322
Gene Namesialic acid binding Ig-like lectin 1, sialoadhesin
SynonymsSn, CD169, Siglec-1
MMRRC Submission 042735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5153 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location131069220-131086765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 131085577 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 103 (V103G)
Ref Sequence ENSEMBL: ENSMUSP00000105855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028794] [ENSMUST00000110226] [ENSMUST00000110227]
Predicted Effect probably damaging
Transcript: ENSMUST00000028794
AA Change: V103G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028794
Gene: ENSMUSG00000027322
AA Change: V103G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 32 142 2.92e-5 SMART
Pfam:C2-set_2 148 235 9.4e-18 PFAM
IGc2 260 319 8.78e-9 SMART
IGc2 344 404 4.07e-4 SMART
IGc2 431 505 3.3e-4 SMART
IGc2 529 589 5.75e-4 SMART
IGc2 622 698 3.54e-4 SMART
low complexity region 700 705 N/A INTRINSIC
IG 716 795 3.35e-5 SMART
IG 804 896 6.51e-3 SMART
IGc2 909 969 4.13e-5 SMART
IG_like 1001 1076 6.78e-2 SMART
low complexity region 1077 1088 N/A INTRINSIC
IG 1094 1171 4.32e-8 SMART
IG_like 1185 1250 1.94e-2 SMART
IG 1268 1345 1.36e-5 SMART
IG_like 1354 1447 1.45e1 SMART
IG_like 1365 1435 4.51e-2 SMART
IG 1454 1534 4.56e-7 SMART
IG_like 1549 1624 1.21e-1 SMART
transmembrane domain 1647 1669 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110226
AA Change: V103G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105855
Gene: ENSMUSG00000027322
AA Change: V103G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 32 142 2.92e-5 SMART
Pfam:C2-set_2 148 235 7.7e-18 PFAM
IGc2 260 319 8.78e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110227
AA Change: V103G

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105856
Gene: ENSMUSG00000027322
AA Change: V103G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 32 142 2.92e-5 SMART
Pfam:C2-set_2 148 235 7e-17 PFAM
IGc2 260 319 8.78e-9 SMART
IGc2 344 404 4.07e-4 SMART
IGc2 431 505 3.3e-4 SMART
IGc2 529 589 5.75e-4 SMART
IGc2 622 698 3.54e-4 SMART
low complexity region 700 705 N/A INTRINSIC
IG 716 795 3.35e-5 SMART
IG 804 896 6.51e-3 SMART
IGc2 909 969 4.13e-5 SMART
IG_like 1001 1076 6.78e-2 SMART
low complexity region 1077 1088 N/A INTRINSIC
IG 1094 1171 4.32e-8 SMART
IG_like 1185 1250 1.94e-2 SMART
IG 1268 1345 1.36e-5 SMART
IG_like 1354 1447 1.45e1 SMART
IG_like 1365 1435 4.51e-2 SMART
IG 1454 1534 4.56e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded protein is a lectin-like adhesion molecule that binds glycoconjugate ligands on cell surfaces in a sialic acid-dependent manner. It is a type I transmembrane protein expressed only by a subpopulation of macrophages and is involved in mediating cell-cell interactions. Alternative splicing produces a transcript variant encoding an isoform that is soluble rather than membrane-bound; however, the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display subtle changes in B- and T-cell populations and decreased IgM levels. Mice homozygous for a knock-out or knock-in allele exhibit impaired phagocytosis of sialylated C. jejuni. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,247 C257S unknown Het
4930596D02Rik C A 14: 35,810,255 R121L probably benign Het
5330417C22Rik A T 3: 108,472,747 Y349N possibly damaging Het
8030411F24Rik A G 2: 148,783,440 Q98R probably benign Het
9430007A20Rik T A 4: 144,522,267 M68K probably benign Het
Acin1 A G 14: 54,645,613 V194A probably benign Het
Acsm1 T C 7: 119,640,727 I298T possibly damaging Het
Aoc1 A G 6: 48,908,747 N729D probably benign Het
Apobr C T 7: 126,587,732 T20I possibly damaging Het
Arsb A G 13: 93,940,598 E491G probably benign Het
AW209491 C G 13: 14,637,179 Q206E probably benign Het
Camsap1 A T 2: 25,933,618 N1473K probably damaging Het
Casp8 A G 1: 58,844,845 Q457R probably benign Het
Ccdc154 G A 17: 25,168,341 A350T probably damaging Het
Cecr2 A G 6: 120,734,560 E183G probably benign Het
Cep295 A T 9: 15,357,629 S39T probably benign Het
Cep350 A T 1: 155,935,946 I416K probably damaging Het
Cidea C T 18: 67,367,420 T184M probably damaging Het
Cnot10 G A 9: 114,613,735 A468V probably damaging Het
Defb22 A T 2: 152,485,802 N154K unknown Het
Dnah17 A T 11: 118,082,974 C1915* probably null Het
Dnah2 T C 11: 69,520,933 T288A possibly damaging Het
Dopey2 T A 16: 93,774,003 M1512K probably damaging Het
Dsp T G 13: 38,182,306 I572S probably damaging Het
Eepd1 A G 9: 25,586,753 H378R probably benign Het
Emilin2 A G 17: 71,273,502 M743T possibly damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
F2rl2 A G 13: 95,697,112 T17A probably benign Het
Fbxl8 T G 8: 105,267,107 C32G probably damaging Het
Fbxw17 A G 13: 50,419,861 T38A probably damaging Het
Flii A T 11: 60,716,686 L882Q possibly damaging Het
Focad T G 4: 88,359,884 S1197A unknown Het
Gm6970 A G 19: 47,170,917 V73A probably damaging Het
Heatr5b G A 17: 78,795,107 R1281* probably null Het
Khdc3 A G 9: 73,103,438 Q190R probably benign Het
Krt9 T A 11: 100,191,242 D244V probably damaging Het
Ldhd T C 8: 111,627,092 E463G probably benign Het
Lig4 A T 8: 9,973,003 V259E possibly damaging Het
Luc7l3 A T 11: 94,295,980 probably benign Het
Man1a2 T C 3: 100,656,263 E22G probably damaging Het
Mmp23 T G 4: 155,651,340 D258A probably damaging Het
Msantd2 C T 9: 37,523,213 R250* probably null Het
Mynn T C 3: 30,611,589 S457P probably benign Het
Nectin1 C T 9: 43,803,498 H50Y probably damaging Het
Olfr1256 G A 2: 89,835,234 T237I possibly damaging Het
Olfr516 T C 7: 108,845,699 I104V probably benign Het
Olfr709-ps1 C T 7: 106,926,569 V297M possibly damaging Het
Olfr804 A G 10: 129,705,157 N93S probably benign Het
Pfkfb2 G A 1: 130,701,790 T303M probably damaging Het
Pkhd1l1 A G 15: 44,505,309 D841G probably benign Het
Plxna4 A T 6: 32,224,159 probably null Het
Podnl1 C T 8: 84,130,643 H294Y probably benign Het
Ppig T A 2: 69,749,650 D509E unknown Het
Ppp1r16a T A 15: 76,694,396 Y433* probably null Het
Prdm1 A C 10: 44,450,225 V134G possibly damaging Het
Prx T C 7: 27,518,476 S940P probably damaging Het
Ptprd C T 4: 76,012,102 V731I probably damaging Het
Qk A G 17: 10,238,891 probably null Het
Rassf6 T C 5: 90,606,840 K206R possibly damaging Het
Rdh16f2 G A 10: 127,876,255 E194K possibly damaging Het
Rims1 C A 1: 22,483,247 G457* probably null Het
Ripk1 T G 13: 34,013,296 I123R probably damaging Het
Rnf111 A T 9: 70,476,140 S170R probably benign Het
Shc3 A T 13: 51,461,377 F181L probably damaging Het
Slc26a11 G T 11: 119,377,259 A488S possibly damaging Het
Smoc2 A T 17: 14,336,579 T97S probably damaging Het
Son T C 16: 91,655,022 I219T possibly damaging Het
Sptbn1 A T 11: 30,121,510 I1474N possibly damaging Het
Syt16 A T 12: 74,222,768 D127V possibly damaging Het
Tet1 G T 10: 62,878,578 N479K possibly damaging Het
Thsd7a G A 6: 12,338,655 A1192V probably benign Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Traj57 A G 14: 54,158,559 probably benign Het
Trpv1 G T 11: 73,238,516 R86S probably benign Het
Usp48 T A 4: 137,616,362 F434L possibly damaging Het
Vmn2r59 A C 7: 42,042,410 probably null Het
Vmn2r71 T A 7: 85,619,222 I211N possibly damaging Het
Vps13b T A 15: 35,422,453 D186E probably damaging Het
Vps33a A G 5: 123,558,628 S321P probably damaging Het
Wdr12 A T 1: 60,094,511 D19E possibly damaging Het
Zc3h12c A G 9: 52,126,647 F278L probably damaging Het
Zpld1 T C 16: 55,246,644 T183A probably damaging Het
Zswim2 G T 2: 83,939,666 T68K possibly damaging Het
Other mutations in Siglec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Siglec1 APN 2 131079325 missense probably benign 0.03
IGL01092:Siglec1 APN 2 131079217 missense probably damaging 1.00
IGL01115:Siglec1 APN 2 131074502 missense probably benign 0.01
IGL01324:Siglec1 APN 2 131085541 missense probably damaging 1.00
IGL01330:Siglec1 APN 2 131083536 missense probably damaging 1.00
IGL01330:Siglec1 APN 2 131075005 nonsense probably null
IGL01558:Siglec1 APN 2 131078499 missense probably damaging 0.96
IGL01632:Siglec1 APN 2 131083820 missense probably benign 0.03
IGL01768:Siglec1 APN 2 131074394 missense probably benign
IGL02399:Siglec1 APN 2 131071178 missense probably benign 0.16
IGL02558:Siglec1 APN 2 131074995 missense possibly damaging 0.88
IGL02794:Siglec1 APN 2 131075969 missense possibly damaging 0.86
IGL02839:Siglec1 APN 2 131084932 missense possibly damaging 0.82
K3955:Siglec1 UTSW 2 131081439 missense probably benign 0.00
P0038:Siglec1 UTSW 2 131081439 missense probably benign 0.00
PIT4576001:Siglec1 UTSW 2 131078161 missense probably damaging 1.00
PIT4677001:Siglec1 UTSW 2 131072757 missense probably damaging 1.00
R0003:Siglec1 UTSW 2 131075060 missense probably benign 0.00
R0048:Siglec1 UTSW 2 131073397 missense possibly damaging 0.65
R0048:Siglec1 UTSW 2 131073397 missense possibly damaging 0.65
R0243:Siglec1 UTSW 2 131085476 missense probably damaging 1.00
R0276:Siglec1 UTSW 2 131083941 nonsense probably null
R0379:Siglec1 UTSW 2 131074525 splice site probably benign
R0464:Siglec1 UTSW 2 131079359 missense probably damaging 1.00
R0507:Siglec1 UTSW 2 131074525 splice site probably benign
R0560:Siglec1 UTSW 2 131070346 missense probably benign 0.02
R0620:Siglec1 UTSW 2 131074268 missense probably benign 0.30
R0621:Siglec1 UTSW 2 131074268 missense probably benign 0.30
R0853:Siglec1 UTSW 2 131085022 missense probably damaging 0.98
R1079:Siglec1 UTSW 2 131079377 nonsense probably null
R1169:Siglec1 UTSW 2 131074827 missense probably damaging 0.97
R1205:Siglec1 UTSW 2 131080464 missense possibly damaging 0.94
R1293:Siglec1 UTSW 2 131073531 missense probably benign 0.00
R1470:Siglec1 UTSW 2 131070387 missense probably benign 0.19
R1470:Siglec1 UTSW 2 131070387 missense probably benign 0.19
R1533:Siglec1 UTSW 2 131076158 missense probably benign
R1717:Siglec1 UTSW 2 131073956 missense possibly damaging 0.92
R1717:Siglec1 UTSW 2 131084012 missense probably damaging 1.00
R1744:Siglec1 UTSW 2 131081299 missense probably damaging 1.00
R1852:Siglec1 UTSW 2 131081500 missense probably damaging 0.98
R1941:Siglec1 UTSW 2 131078131 missense possibly damaging 0.94
R2011:Siglec1 UTSW 2 131083357 missense probably damaging 1.00
R2012:Siglec1 UTSW 2 131083357 missense probably damaging 1.00
R2128:Siglec1 UTSW 2 131080497 missense probably damaging 1.00
R2278:Siglec1 UTSW 2 131071337 missense probably benign 0.28
R2403:Siglec1 UTSW 2 131074475 missense possibly damaging 0.65
R2449:Siglec1 UTSW 2 131078725 missense probably benign 0.44
R2885:Siglec1 UTSW 2 131072747 missense possibly damaging 0.88
R4213:Siglec1 UTSW 2 131074118 missense probably damaging 1.00
R4274:Siglec1 UTSW 2 131085814 missense probably benign 0.00
R4679:Siglec1 UTSW 2 131073411 missense possibly damaging 0.87
R4715:Siglec1 UTSW 2 131074436 missense probably damaging 1.00
R4782:Siglec1 UTSW 2 131075923 missense probably damaging 1.00
R4896:Siglec1 UTSW 2 131069869 missense probably benign 0.21
R4993:Siglec1 UTSW 2 131073361 missense possibly damaging 0.93
R5004:Siglec1 UTSW 2 131069869 missense probably benign 0.21
R5004:Siglec1 UTSW 2 131073411 missense possibly damaging 0.87
R5105:Siglec1 UTSW 2 131080400 missense possibly damaging 0.69
R5137:Siglec1 UTSW 2 131081344 missense probably damaging 1.00
R5311:Siglec1 UTSW 2 131079316 missense probably damaging 1.00
R5600:Siglec1 UTSW 2 131085583 missense probably benign 0.01
R5682:Siglec1 UTSW 2 131084010 missense probably damaging 1.00
R5732:Siglec1 UTSW 2 131074268 missense probably benign 0.30
R5870:Siglec1 UTSW 2 131072847 missense probably damaging 0.99
R5898:Siglec1 UTSW 2 131073633 missense probably damaging 1.00
R5909:Siglec1 UTSW 2 131077964 missense probably damaging 1.00
R6488:Siglec1 UTSW 2 131081307 missense probably damaging 0.99
R6920:Siglec1 UTSW 2 131078077 nonsense probably null
R7064:Siglec1 UTSW 2 131083914 missense probably benign 0.00
R7270:Siglec1 UTSW 2 131081551 missense possibly damaging 0.67
X0024:Siglec1 UTSW 2 131080491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGTCAAAGGACAGGGC -3'
(R):5'- AAGAATGTGCAGGGCTTGTC -3'

Sequencing Primer
(F):5'- CTGGAGCAGCAGCCTAGGAG -3'
(R):5'- CTTGTCGGGATCCTGCCTG -3'
Posted On2016-06-21