Incidental Mutation 'R5153:Slc26a11'
ID395546
Institutional Source Beutler Lab
Gene Symbol Slc26a11
Ensembl Gene ENSMUSG00000039908
Gene Namesolute carrier family 26, member 11
Synonyms
MMRRC Submission 042735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R5153 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location119355557-119381079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119377259 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 488 (A488S)
Ref Sequence ENSEMBL: ENSMUSP00000050999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050880]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050880
AA Change: A488S

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050999
Gene: ENSMUSG00000039908
AA Change: A488S

DomainStartEndE-ValueType
Pfam:Sulfate_transp 31 424 1.8e-97 PFAM
transmembrane domain 426 448 N/A INTRINSIC
Pfam:STAS 453 559 3.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151612
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute linked carrier 26 family of anion exchangers. Members of this family of proteins are essential for numerous cellular functions including homeostasis and intracellular electrolyte balance. The encoded protein is a sodium independent sulfate transporter that is sensitive to the anion exchanger inhibitor 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,247 C257S unknown Het
4930596D02Rik C A 14: 35,810,255 R121L probably benign Het
5330417C22Rik A T 3: 108,472,747 Y349N possibly damaging Het
8030411F24Rik A G 2: 148,783,440 Q98R probably benign Het
9430007A20Rik T A 4: 144,522,267 M68K probably benign Het
Acin1 A G 14: 54,645,613 V194A probably benign Het
Acsm1 T C 7: 119,640,727 I298T possibly damaging Het
Aoc1 A G 6: 48,908,747 N729D probably benign Het
Apobr C T 7: 126,587,732 T20I possibly damaging Het
Arsb A G 13: 93,940,598 E491G probably benign Het
AW209491 C G 13: 14,637,179 Q206E probably benign Het
Camsap1 A T 2: 25,933,618 N1473K probably damaging Het
Casp8 A G 1: 58,844,845 Q457R probably benign Het
Ccdc154 G A 17: 25,168,341 A350T probably damaging Het
Cecr2 A G 6: 120,734,560 E183G probably benign Het
Cep295 A T 9: 15,357,629 S39T probably benign Het
Cep350 A T 1: 155,935,946 I416K probably damaging Het
Cidea C T 18: 67,367,420 T184M probably damaging Het
Cnot10 G A 9: 114,613,735 A468V probably damaging Het
Defb22 A T 2: 152,485,802 N154K unknown Het
Dnah17 A T 11: 118,082,974 C1915* probably null Het
Dnah2 T C 11: 69,520,933 T288A possibly damaging Het
Dopey2 T A 16: 93,774,003 M1512K probably damaging Het
Dsp T G 13: 38,182,306 I572S probably damaging Het
Eepd1 A G 9: 25,586,753 H378R probably benign Het
Emilin2 A G 17: 71,273,502 M743T possibly damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
F2rl2 A G 13: 95,697,112 T17A probably benign Het
Fbxl8 T G 8: 105,267,107 C32G probably damaging Het
Fbxw17 A G 13: 50,419,861 T38A probably damaging Het
Flii A T 11: 60,716,686 L882Q possibly damaging Het
Focad T G 4: 88,359,884 S1197A unknown Het
Gm6970 A G 19: 47,170,917 V73A probably damaging Het
Heatr5b G A 17: 78,795,107 R1281* probably null Het
Khdc3 A G 9: 73,103,438 Q190R probably benign Het
Krt9 T A 11: 100,191,242 D244V probably damaging Het
Ldhd T C 8: 111,627,092 E463G probably benign Het
Lig4 A T 8: 9,973,003 V259E possibly damaging Het
Luc7l3 A T 11: 94,295,980 probably benign Het
Man1a2 T C 3: 100,656,263 E22G probably damaging Het
Mmp23 T G 4: 155,651,340 D258A probably damaging Het
Msantd2 C T 9: 37,523,213 R250* probably null Het
Mynn T C 3: 30,611,589 S457P probably benign Het
Nectin1 C T 9: 43,803,498 H50Y probably damaging Het
Olfr1256 G A 2: 89,835,234 T237I possibly damaging Het
Olfr516 T C 7: 108,845,699 I104V probably benign Het
Olfr709-ps1 C T 7: 106,926,569 V297M possibly damaging Het
Olfr804 A G 10: 129,705,157 N93S probably benign Het
Pfkfb2 G A 1: 130,701,790 T303M probably damaging Het
Pkhd1l1 A G 15: 44,505,309 D841G probably benign Het
Plxna4 A T 6: 32,224,159 probably null Het
Podnl1 C T 8: 84,130,643 H294Y probably benign Het
Ppig T A 2: 69,749,650 D509E unknown Het
Ppp1r16a T A 15: 76,694,396 Y433* probably null Het
Prdm1 A C 10: 44,450,225 V134G possibly damaging Het
Prx T C 7: 27,518,476 S940P probably damaging Het
Ptprd C T 4: 76,012,102 V731I probably damaging Het
Qk A G 17: 10,238,891 probably null Het
Rassf6 T C 5: 90,606,840 K206R possibly damaging Het
Rdh16f2 G A 10: 127,876,255 E194K possibly damaging Het
Rims1 C A 1: 22,483,247 G457* probably null Het
Ripk1 T G 13: 34,013,296 I123R probably damaging Het
Rnf111 A T 9: 70,476,140 S170R probably benign Het
Shc3 A T 13: 51,461,377 F181L probably damaging Het
Siglec1 A C 2: 131,085,577 V103G probably damaging Het
Smoc2 A T 17: 14,336,579 T97S probably damaging Het
Son T C 16: 91,655,022 I219T possibly damaging Het
Sptbn1 A T 11: 30,121,510 I1474N possibly damaging Het
Syt16 A T 12: 74,222,768 D127V possibly damaging Het
Tet1 G T 10: 62,878,578 N479K possibly damaging Het
Thsd7a G A 6: 12,338,655 A1192V probably benign Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Traj57 A G 14: 54,158,559 probably benign Het
Trpv1 G T 11: 73,238,516 R86S probably benign Het
Usp48 T A 4: 137,616,362 F434L possibly damaging Het
Vmn2r59 A C 7: 42,042,410 probably null Het
Vmn2r71 T A 7: 85,619,222 I211N possibly damaging Het
Vps13b T A 15: 35,422,453 D186E probably damaging Het
Vps33a A G 5: 123,558,628 S321P probably damaging Het
Wdr12 A T 1: 60,094,511 D19E possibly damaging Het
Zc3h12c A G 9: 52,126,647 F278L probably damaging Het
Zpld1 T C 16: 55,246,644 T183A probably damaging Het
Zswim2 G T 2: 83,939,666 T68K possibly damaging Het
Other mutations in Slc26a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Slc26a11 APN 11 119379901 missense probably benign 0.00
IGL01359:Slc26a11 APN 11 119363431 missense probably benign 0.00
IGL01835:Slc26a11 APN 11 119377214 missense probably benign
R0193:Slc26a11 UTSW 11 119359314 missense probably damaging 1.00
R0362:Slc26a11 UTSW 11 119379941 splice site probably benign
R0709:Slc26a11 UTSW 11 119374777 missense probably damaging 1.00
R1800:Slc26a11 UTSW 11 119373153 missense probably damaging 0.97
R1964:Slc26a11 UTSW 11 119380194 missense possibly damaging 0.93
R4762:Slc26a11 UTSW 11 119356831 unclassified probably benign
R5302:Slc26a11 UTSW 11 119363450 missense probably damaging 0.99
R5660:Slc26a11 UTSW 11 119357978 missense probably damaging 0.98
R5994:Slc26a11 UTSW 11 119379912 missense probably benign 0.14
R6025:Slc26a11 UTSW 11 119374828 missense probably damaging 1.00
R6275:Slc26a11 UTSW 11 119359299 missense probably benign 0.44
R6970:Slc26a11 UTSW 11 119356972 missense probably damaging 1.00
R6974:Slc26a11 UTSW 11 119358018 missense possibly damaging 0.82
X0026:Slc26a11 UTSW 11 119380230 missense probably benign
X0028:Slc26a11 UTSW 11 119380194 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCCTGGTGCAGTGATCGAAG -3'
(R):5'- GAAGCAAACATGGCCCTTAC -3'

Sequencing Primer
(F):5'- GAAGCCTCGAAGACTCTCCTGTC -3'
(R):5'- ACATGGCCCTTACTGACAGG -3'
Posted On2016-06-21