Incidental Mutation 'R5153:Ppp1r16a'
ID395562
Institutional Source Beutler Lab
Gene Symbol Ppp1r16a
Ensembl Gene ENSMUSG00000033819
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 16A
SynonymsR75527, Mypt3, 2900084E10Rik
MMRRC Submission 042735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5153 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76671615-76694919 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 76694396 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 433 (Y433*)
Ref Sequence ENSEMBL: ENSMUSP00000155515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023203] [ENSMUST00000037551] [ENSMUST00000135388] [ENSMUST00000150399] [ENSMUST00000229140] [ENSMUST00000229679] [ENSMUST00000229734] [ENSMUST00000231028]
Predicted Effect probably benign
Transcript: ENSMUST00000023203
SMART Domains Protein: ENSMUSP00000023203
Gene: ENSMUSG00000022546

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 83 484 7.8e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000037551
AA Change: Y433*
SMART Domains Protein: ENSMUSP00000037356
Gene: ENSMUSG00000033819
AA Change: Y433*

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
ANK 231 260 2.58e-3 SMART
ANK 264 293 4.03e-5 SMART
low complexity region 323 346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134449
Predicted Effect probably null
Transcript: ENSMUST00000135388
AA Change: Y433*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143274
Predicted Effect probably benign
Transcript: ENSMUST00000150399
SMART Domains Protein: ENSMUSP00000123458
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228987
Predicted Effect probably benign
Transcript: ENSMUST00000229140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229340
Predicted Effect probably benign
Transcript: ENSMUST00000229679
Predicted Effect probably benign
Transcript: ENSMUST00000229734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230482
Predicted Effect probably benign
Transcript: ENSMUST00000231028
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin light chain kinase and phosphatase (MLCP) complexes control the phosphorylation states of regulatory myosin light chains, which is crucial for muscle and intracellular movement. MLCPs typically contain a catalytic protein phosphatase 1 (PP1c) subunit, a myosin phosphatase targeting (MYPT) subunit, and another smaller subunit. The protein encoded by this gene represents an MYPT subunit, which is responsible for directing PP1c to its intended targets. However, while other MYPTs result in PP1c activation after becoming phosphorylated, the encoded protein is phosphorylated by protein kinase A and then inhibits the catalytic activity of PP1c. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,247 C257S unknown Het
4930596D02Rik C A 14: 35,810,255 R121L probably benign Het
5330417C22Rik A T 3: 108,472,747 Y349N possibly damaging Het
8030411F24Rik A G 2: 148,783,440 Q98R probably benign Het
9430007A20Rik T A 4: 144,522,267 M68K probably benign Het
Acin1 A G 14: 54,645,613 V194A probably benign Het
Acsm1 T C 7: 119,640,727 I298T possibly damaging Het
Aoc1 A G 6: 48,908,747 N729D probably benign Het
Apobr C T 7: 126,587,732 T20I possibly damaging Het
Arsb A G 13: 93,940,598 E491G probably benign Het
AW209491 C G 13: 14,637,179 Q206E probably benign Het
Camsap1 A T 2: 25,933,618 N1473K probably damaging Het
Casp8 A G 1: 58,844,845 Q457R probably benign Het
Ccdc154 G A 17: 25,168,341 A350T probably damaging Het
Cecr2 A G 6: 120,734,560 E183G probably benign Het
Cep295 A T 9: 15,357,629 S39T probably benign Het
Cep350 A T 1: 155,935,946 I416K probably damaging Het
Cidea C T 18: 67,367,420 T184M probably damaging Het
Cnot10 G A 9: 114,613,735 A468V probably damaging Het
Defb22 A T 2: 152,485,802 N154K unknown Het
Dnah17 A T 11: 118,082,974 C1915* probably null Het
Dnah2 T C 11: 69,520,933 T288A possibly damaging Het
Dopey2 T A 16: 93,774,003 M1512K probably damaging Het
Dsp T G 13: 38,182,306 I572S probably damaging Het
Eepd1 A G 9: 25,586,753 H378R probably benign Het
Emilin2 A G 17: 71,273,502 M743T possibly damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
F2rl2 A G 13: 95,697,112 T17A probably benign Het
Fbxl8 T G 8: 105,267,107 C32G probably damaging Het
Fbxw17 A G 13: 50,419,861 T38A probably damaging Het
Flii A T 11: 60,716,686 L882Q possibly damaging Het
Focad T G 4: 88,359,884 S1197A unknown Het
Gm6970 A G 19: 47,170,917 V73A probably damaging Het
Heatr5b G A 17: 78,795,107 R1281* probably null Het
Khdc3 A G 9: 73,103,438 Q190R probably benign Het
Krt9 T A 11: 100,191,242 D244V probably damaging Het
Ldhd T C 8: 111,627,092 E463G probably benign Het
Lig4 A T 8: 9,973,003 V259E possibly damaging Het
Luc7l3 A T 11: 94,295,980 probably benign Het
Man1a2 T C 3: 100,656,263 E22G probably damaging Het
Mmp23 T G 4: 155,651,340 D258A probably damaging Het
Msantd2 C T 9: 37,523,213 R250* probably null Het
Mynn T C 3: 30,611,589 S457P probably benign Het
Nectin1 C T 9: 43,803,498 H50Y probably damaging Het
Olfr1256 G A 2: 89,835,234 T237I possibly damaging Het
Olfr516 T C 7: 108,845,699 I104V probably benign Het
Olfr709-ps1 C T 7: 106,926,569 V297M possibly damaging Het
Olfr804 A G 10: 129,705,157 N93S probably benign Het
Pfkfb2 G A 1: 130,701,790 T303M probably damaging Het
Pkhd1l1 A G 15: 44,505,309 D841G probably benign Het
Plxna4 A T 6: 32,224,159 probably null Het
Podnl1 C T 8: 84,130,643 H294Y probably benign Het
Ppig T A 2: 69,749,650 D509E unknown Het
Prdm1 A C 10: 44,450,225 V134G possibly damaging Het
Prx T C 7: 27,518,476 S940P probably damaging Het
Ptprd C T 4: 76,012,102 V731I probably damaging Het
Qk A G 17: 10,238,891 probably null Het
Rassf6 T C 5: 90,606,840 K206R possibly damaging Het
Rdh16f2 G A 10: 127,876,255 E194K possibly damaging Het
Rims1 C A 1: 22,483,247 G457* probably null Het
Ripk1 T G 13: 34,013,296 I123R probably damaging Het
Rnf111 A T 9: 70,476,140 S170R probably benign Het
Shc3 A T 13: 51,461,377 F181L probably damaging Het
Siglec1 A C 2: 131,085,577 V103G probably damaging Het
Slc26a11 G T 11: 119,377,259 A488S possibly damaging Het
Smoc2 A T 17: 14,336,579 T97S probably damaging Het
Son T C 16: 91,655,022 I219T possibly damaging Het
Sptbn1 A T 11: 30,121,510 I1474N possibly damaging Het
Syt16 A T 12: 74,222,768 D127V possibly damaging Het
Tet1 G T 10: 62,878,578 N479K possibly damaging Het
Thsd7a G A 6: 12,338,655 A1192V probably benign Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Traj57 A G 14: 54,158,559 probably benign Het
Trpv1 G T 11: 73,238,516 R86S probably benign Het
Usp48 T A 4: 137,616,362 F434L possibly damaging Het
Vmn2r59 A C 7: 42,042,410 probably null Het
Vmn2r71 T A 7: 85,619,222 I211N possibly damaging Het
Vps13b T A 15: 35,422,453 D186E probably damaging Het
Vps33a A G 5: 123,558,628 S321P probably damaging Het
Wdr12 A T 1: 60,094,511 D19E possibly damaging Het
Zc3h12c A G 9: 52,126,647 F278L probably damaging Het
Zpld1 T C 16: 55,246,644 T183A probably damaging Het
Zswim2 G T 2: 83,939,666 T68K possibly damaging Het
Other mutations in Ppp1r16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Ppp1r16a APN 15 76694544 missense probably benign
IGL01449:Ppp1r16a APN 15 76694294 unclassified probably benign
IGL02128:Ppp1r16a APN 15 76693978 missense probably benign
IGL02331:Ppp1r16a APN 15 76691000 missense probably benign
R0057:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0060:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0113:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0114:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0244:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0352:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0646:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0652:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0722:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0744:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0833:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0834:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0835:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0836:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0885:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0942:Ppp1r16a UTSW 15 76694011 missense probably damaging 0.98
R1061:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1168:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1170:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1171:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1503:Ppp1r16a UTSW 15 76694399 missense probably benign
R1572:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1914:Ppp1r16a UTSW 15 76693068 missense probably damaging 1.00
R1915:Ppp1r16a UTSW 15 76693068 missense probably damaging 1.00
R2085:Ppp1r16a UTSW 15 76693596 missense probably damaging 0.99
R4823:Ppp1r16a UTSW 15 76693193 unclassified probably benign
R5443:Ppp1r16a UTSW 15 76694646 missense possibly damaging 0.95
R5481:Ppp1r16a UTSW 15 76691021 missense probably damaging 1.00
R6900:Ppp1r16a UTSW 15 76691723 missense probably damaging 1.00
R7165:Ppp1r16a UTSW 15 76690904 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCTGCTGCTGACATGGC -3'
(R):5'- TTGTGCTGAAGCCACAGTCAG -3'

Sequencing Primer
(F):5'- GTCTACTACCACTTCACACAAACTTG -3'
(R):5'- AGTCAGGCTGGGAGGTC -3'
Posted On2016-06-21