Incidental Mutation 'R5164:Ebf2'
ID395611
Institutional Source Beutler Lab
Gene Symbol Ebf2
Ensembl Gene ENSMUSG00000022053
Gene Nameearly B cell factor 2
SynonymsMmot1, D14Ggc1e, O/E-3
MMRRC Submission 042745-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.854) question?
Stock #R5164 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location67233292-67430918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67390521 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 322 (S322P)
Ref Sequence ENSEMBL: ENSMUSP00000135500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022637] [ENSMUST00000176029] [ENSMUST00000176161]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022637
AA Change: S322P

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022637
Gene: ENSMUSG00000022053
AA Change: S322P

DomainStartEndE-ValueType
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176029
AA Change: S322P

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135782
Gene: ENSMUSG00000022053
AA Change: S322P

DomainStartEndE-ValueType
Pfam:COE1_DBD 16 246 2.3e-145 PFAM
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176161
AA Change: S322P

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135500
Gene: ENSMUSG00000022053
AA Change: S322P

DomainStartEndE-ValueType
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176841
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the COE (Collier/Olf/EBF) family of non-basic, helix-loop-helix transcription factors that have a well conserved DNA binding domain. The COE family proteins play an important role in variety of developmental processes. Studies in mouse suggest that this gene may be involved in the differentiation of osteoblasts. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mutants show decreased viability, impaired olfactory neuron projection, and impaired mating, more so in male mice. Mice homozygous for another knock-out allele exhibit narcolepsy-cataplexy syndrome and decreased orexinergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,435,674 H4637Q probably benign Het
Akap6 A G 12: 53,142,466 H2221R probably benign Het
Arsj A T 3: 126,438,159 M185L probably benign Het
Ccdc177 T C 12: 80,758,562 T313A unknown Het
Cdkal1 A T 13: 29,625,719 L214H probably damaging Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Cfap65 T C 1: 74,926,516 K445R probably damaging Het
Chrnb3 T A 8: 27,394,132 I299N probably damaging Het
Cse1l C A 2: 166,944,428 D826E probably benign Het
Cwf19l2 T C 9: 3,475,511 V816A probably damaging Het
Dnah5 A T 15: 28,408,292 E3474D probably benign Het
Dock5 A T 14: 67,817,661 Y585* probably null Het
Epha8 T C 4: 136,945,672 E267G possibly damaging Het
Fam126b T C 1: 58,535,438 T315A probably benign Het
Fkbp5 A G 17: 28,437,990 probably null Het
Gbp4 T A 5: 105,136,877 K49* probably null Het
Gm13212 T C 4: 145,622,205 Y71H probably damaging Het
Gramd4 A T 15: 86,100,831 T98S probably benign Het
H2-Ke6 A G 17: 34,026,978 probably benign Het
Hectd1 C A 12: 51,827,489 M1I probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Keg1 A G 19: 12,714,680 probably benign Het
Lilra6 A T 7: 3,914,881 V88E probably damaging Het
Mast1 A G 8: 84,913,518 probably benign Het
Mdn1 A G 4: 32,759,011 probably null Het
Nrd1 C T 4: 109,039,717 T511I probably damaging Het
Olfr1058 T C 2: 86,385,471 T316A probably benign Het
Olfr1204 T A 2: 88,852,570 L207I probably benign Het
Olfr478 G A 7: 108,032,280 T21I possibly damaging Het
Pms1 A G 1: 53,207,640 V301A probably damaging Het
Pnisr A T 4: 21,859,237 Q144L possibly damaging Het
Pp2d1 G T 17: 53,508,070 T542K probably benign Het
Ppargc1b A T 18: 61,302,644 C922S probably damaging Het
Ptprd T C 4: 76,100,758 probably null Het
Runx3 T C 4: 135,121,130 S9P possibly damaging Het
Serpina1b A G 12: 103,732,087 S168P probably benign Het
Slc14a2 G A 18: 78,157,272 A722V probably damaging Het
Slc23a2 T A 2: 132,075,450 probably benign Het
Slc47a1 A G 11: 61,353,060 probably null Het
Tcf20 A G 15: 82,856,603 S216P probably damaging Het
Tpst1 T A 5: 130,102,001 I104N probably damaging Het
Ttc25 G A 11: 100,571,520 W506* probably null Het
Ufm1 A C 3: 53,857,927 probably benign Het
Unkl A G 17: 25,213,109 probably null Het
Usf3 T C 16: 44,218,180 S1008P probably damaging Het
Ythdf3 T C 3: 16,183,513 V6A possibly damaging Het
Zc3h3 A T 15: 75,777,026 S752R probably benign Het
Other mutations in Ebf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Ebf2 APN 14 67239478 missense probably damaging 1.00
IGL01808:Ebf2 APN 14 67414483 missense probably benign 0.01
IGL02087:Ebf2 APN 14 67428096 missense probably benign 0.03
IGL02094:Ebf2 APN 14 67235240 missense possibly damaging 0.80
IGL02270:Ebf2 APN 14 67238953 missense probably damaging 1.00
IGL03222:Ebf2 APN 14 67411992 splice site probably null
IGL03390:Ebf2 APN 14 67424109 missense probably benign 0.19
R0044:Ebf2 UTSW 14 67310968 intron probably benign
R0062:Ebf2 UTSW 14 67238540 splice site probably benign
R0062:Ebf2 UTSW 14 67238540 splice site probably benign
R0069:Ebf2 UTSW 14 67410050 missense probably damaging 0.99
R0069:Ebf2 UTSW 14 67410050 missense probably damaging 0.99
R0505:Ebf2 UTSW 14 67371736 nonsense probably null
R2103:Ebf2 UTSW 14 67387942 missense probably damaging 1.00
R2438:Ebf2 UTSW 14 67387942 missense probably damaging 1.00
R3789:Ebf2 UTSW 14 67239493 critical splice donor site probably null
R4153:Ebf2 UTSW 14 67235223 missense probably damaging 1.00
R4348:Ebf2 UTSW 14 67239422 missense probably damaging 0.99
R4793:Ebf2 UTSW 14 67410082 missense probably damaging 1.00
R4991:Ebf2 UTSW 14 67389657 missense possibly damaging 0.87
R5222:Ebf2 UTSW 14 67313594 intron probably benign
R5227:Ebf2 UTSW 14 67247069 missense probably damaging 0.99
R5459:Ebf2 UTSW 14 67235201 missense probably benign 0.34
R5622:Ebf2 UTSW 14 67390558 missense possibly damaging 0.91
R6035:Ebf2 UTSW 14 67238974 missense probably damaging 1.00
R6035:Ebf2 UTSW 14 67238974 missense probably damaging 1.00
R6265:Ebf2 UTSW 14 67424060 missense probably benign 0.00
R6893:Ebf2 UTSW 14 67237559 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGGGCTTGGCAGTTGTCAAAC -3'
(R):5'- ACCATGCAGAAGTTTCTCAGG -3'

Sequencing Primer
(F):5'- GCAGTTGTCAAACTAATATGAGGCC -3'
(R):5'- CCATGCAGAAGTTTCTCAGGTCAAG -3'
Posted On2016-06-21