Incidental Mutation 'R5164:Zc3h3'
ID395614
Institutional Source Beutler Lab
Gene Symbol Zc3h3
Ensembl Gene ENSMUSG00000075600
Gene Namezinc finger CCCH type containing 3
SynonymsSmicl
MMRRC Submission 042745-MU
Accession Numbers

Genbank: NM_172121.1; Ensembl: ENSMUST00000100538

Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R5164 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location75754430-75841915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75777026 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 752 (S752R)
Ref Sequence ENSEMBL: ENSMUSP00000098106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100538]
Predicted Effect probably benign
Transcript: ENSMUST00000100538
AA Change: S752R

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000098106
Gene: ENSMUSG00000075600
AA Change: S752R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 370 388 N/A INTRINSIC
low complexity region 543 558 N/A INTRINSIC
ZnF_C3H1 663 689 1.03e-2 SMART
ZnF_C3H1 690 716 1.16e-1 SMART
ZnF_C3H1 718 743 5.38e-6 SMART
ZnF_C3H1 745 771 2.88e-6 SMART
ZnF_C3H1 772 794 1.64e-1 SMART
low complexity region 839 888 N/A INTRINSIC
low complexity region 895 905 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229970
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (49/50)
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,435,674 H4637Q probably benign Het
Akap6 A G 12: 53,142,466 H2221R probably benign Het
Arsj A T 3: 126,438,159 M185L probably benign Het
Ccdc177 T C 12: 80,758,562 T313A unknown Het
Cdkal1 A T 13: 29,625,719 L214H probably damaging Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Cfap65 T C 1: 74,926,516 K445R probably damaging Het
Chrnb3 T A 8: 27,394,132 I299N probably damaging Het
Cse1l C A 2: 166,944,428 D826E probably benign Het
Cwf19l2 T C 9: 3,475,511 V816A probably damaging Het
Dnah5 A T 15: 28,408,292 E3474D probably benign Het
Dock5 A T 14: 67,817,661 Y585* probably null Het
Ebf2 T C 14: 67,390,521 S322P possibly damaging Het
Epha8 T C 4: 136,945,672 E267G possibly damaging Het
Fam126b T C 1: 58,535,438 T315A probably benign Het
Fkbp5 A G 17: 28,437,990 probably null Het
Gbp4 T A 5: 105,136,877 K49* probably null Het
Gm13212 T C 4: 145,622,205 Y71H probably damaging Het
Gramd4 A T 15: 86,100,831 T98S probably benign Het
H2-Ke6 A G 17: 34,026,978 probably benign Het
Hectd1 C A 12: 51,827,489 M1I probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Keg1 A G 19: 12,714,680 probably benign Het
Lilra6 A T 7: 3,914,881 V88E probably damaging Het
Mast1 A G 8: 84,913,518 probably benign Het
Mdn1 A G 4: 32,759,011 probably null Het
Nrd1 C T 4: 109,039,717 T511I probably damaging Het
Olfr1058 T C 2: 86,385,471 T316A probably benign Het
Olfr1204 T A 2: 88,852,570 L207I probably benign Het
Olfr478 G A 7: 108,032,280 T21I possibly damaging Het
Pms1 A G 1: 53,207,640 V301A probably damaging Het
Pnisr A T 4: 21,859,237 Q144L possibly damaging Het
Pp2d1 G T 17: 53,508,070 T542K probably benign Het
Ppargc1b A T 18: 61,302,644 C922S probably damaging Het
Ptprd T C 4: 76,100,758 probably null Het
Runx3 T C 4: 135,121,130 S9P possibly damaging Het
Serpina1b A G 12: 103,732,087 S168P probably benign Het
Slc14a2 G A 18: 78,157,272 A722V probably damaging Het
Slc23a2 T A 2: 132,075,450 probably benign Het
Slc47a1 A G 11: 61,353,060 probably null Het
Tcf20 A G 15: 82,856,603 S216P probably damaging Het
Tpst1 T A 5: 130,102,001 I104N probably damaging Het
Ttc25 G A 11: 100,571,520 W506* probably null Het
Ufm1 A C 3: 53,857,927 probably benign Het
Unkl A G 17: 25,213,109 probably null Het
Usf3 T C 16: 44,218,180 S1008P probably damaging Het
Ythdf3 T C 3: 16,183,513 V6A possibly damaging Het
Other mutations in Zc3h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Zc3h3 APN 15 75779313 missense probably damaging 1.00
1mM(1):Zc3h3 UTSW 15 75840565 critical splice acceptor site probably null
R0477:Zc3h3 UTSW 15 75777083 missense possibly damaging 0.93
R0843:Zc3h3 UTSW 15 75837479 missense probably benign 0.00
R1891:Zc3h3 UTSW 15 75756931 missense possibly damaging 0.47
R1918:Zc3h3 UTSW 15 75777118 missense probably damaging 1.00
R2009:Zc3h3 UTSW 15 75779309 missense probably damaging 1.00
R2257:Zc3h3 UTSW 15 75839566 missense possibly damaging 0.77
R3853:Zc3h3 UTSW 15 75837497 missense probably benign 0.03
R5130:Zc3h3 UTSW 15 75779290 missense probably damaging 1.00
R5160:Zc3h3 UTSW 15 75809663 missense probably benign 0.02
R5279:Zc3h3 UTSW 15 75839590 missense probably benign 0.08
R5622:Zc3h3 UTSW 15 75777079 missense probably damaging 1.00
R5743:Zc3h3 UTSW 15 75779531 nonsense probably null
R5923:Zc3h3 UTSW 15 75785564 missense probably damaging 0.99
R6294:Zc3h3 UTSW 15 75809568 missense possibly damaging 0.90
R6377:Zc3h3 UTSW 15 75839455 missense probably damaging 0.99
R6735:Zc3h3 UTSW 15 75756634 missense probably benign 0.00
R7043:Zc3h3 UTSW 15 75809636 missense probably damaging 1.00
R7231:Zc3h3 UTSW 15 75840382 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGCTGTACCCCTCAGTC -3'
(R):5'- TGATGGTCTCCAGCAGAATCTG -3'

Sequencing Primer
(F):5'- ACCCCTCAGTCATTTGTGAGATGG -3'
(R):5'- CTCTCAAGGGCCTGCAAGTTTG -3'
Posted On2016-06-21