Incidental Mutation 'R5164:Cfap44'
ID395618
Institutional Source Beutler Lab
Gene Symbol Cfap44
Ensembl Gene ENSMUSG00000071550
Gene Namecilia and flagella associated protein 44
Synonyms6330444M21Rik, D16Ertd642e, Wdr52
MMRRC Submission 042745-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5164 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location44394796-44482428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44481389 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1830 (I1830N)
Ref Sequence ENSEMBL: ENSMUSP00000113908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000114634] [ENSMUST00000120049]
Predicted Effect probably damaging
Transcript: ENSMUST00000099742
AA Change: I1830N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550
AA Change: I1830N

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114634
SMART Domains Protein: ENSMUSP00000110281
Gene: ENSMUSG00000022687

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IGc2 43 108 4.36e-4 SMART
IG 130 217 8.99e-6 SMART
IGc2 238 301 3.94e-11 SMART
IGc2 330 393 1.46e-14 SMART
low complexity region 423 433 N/A INTRINSIC
FN3 467 553 1.14e-5 SMART
FN3 601 685 3.53e-11 SMART
FN3 707 794 4.25e-5 SMART
low complexity region 813 829 N/A INTRINSIC
transmembrane domain 851 873 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120049
AA Change: I1830N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550
AA Change: I1830N

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125719
SMART Domains Protein: ENSMUSP00000115502
Gene: ENSMUSG00000071550

DomainStartEndE-ValueType
coiled coil region 33 90 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
low complexity region 121 155 N/A INTRINSIC
coiled coil region 174 238 N/A INTRINSIC
coiled coil region 261 362 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127303
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by multiple sperm axonemal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,435,674 H4637Q probably benign Het
Akap6 A G 12: 53,142,466 H2221R probably benign Het
Arsj A T 3: 126,438,159 M185L probably benign Het
Ccdc177 T C 12: 80,758,562 T313A unknown Het
Cdkal1 A T 13: 29,625,719 L214H probably damaging Het
Cfap65 T C 1: 74,926,516 K445R probably damaging Het
Chrnb3 T A 8: 27,394,132 I299N probably damaging Het
Cse1l C A 2: 166,944,428 D826E probably benign Het
Cwf19l2 T C 9: 3,475,511 V816A probably damaging Het
Dnah5 A T 15: 28,408,292 E3474D probably benign Het
Dock5 A T 14: 67,817,661 Y585* probably null Het
Ebf2 T C 14: 67,390,521 S322P possibly damaging Het
Epha8 T C 4: 136,945,672 E267G possibly damaging Het
Fam126b T C 1: 58,535,438 T315A probably benign Het
Fkbp5 A G 17: 28,437,990 probably null Het
Gbp4 T A 5: 105,136,877 K49* probably null Het
Gm13212 T C 4: 145,622,205 Y71H probably damaging Het
Gramd4 A T 15: 86,100,831 T98S probably benign Het
H2-Ke6 A G 17: 34,026,978 probably benign Het
Hectd1 C A 12: 51,827,489 M1I probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Keg1 A G 19: 12,714,680 probably benign Het
Lilra6 A T 7: 3,914,881 V88E probably damaging Het
Mast1 A G 8: 84,913,518 probably benign Het
Mdn1 A G 4: 32,759,011 probably null Het
Nrd1 C T 4: 109,039,717 T511I probably damaging Het
Olfr1058 T C 2: 86,385,471 T316A probably benign Het
Olfr1204 T A 2: 88,852,570 L207I probably benign Het
Olfr478 G A 7: 108,032,280 T21I possibly damaging Het
Pms1 A G 1: 53,207,640 V301A probably damaging Het
Pnisr A T 4: 21,859,237 Q144L possibly damaging Het
Pp2d1 G T 17: 53,508,070 T542K probably benign Het
Ppargc1b A T 18: 61,302,644 C922S probably damaging Het
Ptprd T C 4: 76,100,758 probably null Het
Runx3 T C 4: 135,121,130 S9P possibly damaging Het
Serpina1b A G 12: 103,732,087 S168P probably benign Het
Slc14a2 G A 18: 78,157,272 A722V probably damaging Het
Slc23a2 T A 2: 132,075,450 probably benign Het
Slc47a1 A G 11: 61,353,060 probably null Het
Tcf20 A G 15: 82,856,603 S216P probably damaging Het
Tpst1 T A 5: 130,102,001 I104N probably damaging Het
Ttc25 G A 11: 100,571,520 W506* probably null Het
Ufm1 A C 3: 53,857,927 probably benign Het
Unkl A G 17: 25,213,109 probably null Het
Usf3 T C 16: 44,218,180 S1008P probably damaging Het
Ythdf3 T C 3: 16,183,513 V6A possibly damaging Het
Zc3h3 A T 15: 75,777,026 S752R probably benign Het
Other mutations in Cfap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Cfap44 APN 16 44407404 missense probably damaging 0.99
IGL00952:Cfap44 APN 16 44421275 missense probably benign 0.33
IGL01340:Cfap44 APN 16 44404130 missense probably damaging 1.00
IGL01530:Cfap44 APN 16 44449167 missense probably damaging 1.00
IGL02083:Cfap44 APN 16 44437162 missense probably damaging 1.00
IGL02088:Cfap44 APN 16 44451628 missense possibly damaging 0.59
IGL02142:Cfap44 APN 16 44421144 missense probably benign 0.15
IGL02311:Cfap44 APN 16 44404771 splice site probably benign
IGL02574:Cfap44 APN 16 44481383 missense probably damaging 1.00
IGL02893:Cfap44 APN 16 44416817 missense probably damaging 1.00
IGL02959:Cfap44 APN 16 44470867 splice site probably benign
IGL03291:Cfap44 APN 16 44407311 missense possibly damaging 0.86
feldgrau UTSW 16 44433666 nonsense probably null
I2288:Cfap44 UTSW 16 44449138 nonsense probably null
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0036:Cfap44 UTSW 16 44439069 missense possibly damaging 0.83
R0139:Cfap44 UTSW 16 44433422 missense possibly damaging 0.90
R0145:Cfap44 UTSW 16 44468372 missense probably damaging 1.00
R0193:Cfap44 UTSW 16 44449210 splice site probably null
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0288:Cfap44 UTSW 16 44415894 splice site probably benign
R0367:Cfap44 UTSW 16 44433476 critical splice donor site probably null
R0452:Cfap44 UTSW 16 44431945 missense probably benign 0.01
R0531:Cfap44 UTSW 16 44401426 start codon destroyed probably benign 0.01
R0722:Cfap44 UTSW 16 44404676 missense possibly damaging 0.94
R0801:Cfap44 UTSW 16 44422486 missense probably benign 0.41
R1209:Cfap44 UTSW 16 44422417 missense possibly damaging 0.86
R1215:Cfap44 UTSW 16 44419303 missense probably damaging 1.00
R1385:Cfap44 UTSW 16 44470775 missense probably damaging 1.00
R1400:Cfap44 UTSW 16 44421212 missense probably benign 0.01
R1415:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R1475:Cfap44 UTSW 16 44433812 splice site probably benign
R1901:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1902:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1903:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R2023:Cfap44 UTSW 16 44416012 missense probably benign 0.01
R2126:Cfap44 UTSW 16 44410475 missense probably benign 0.40
R2147:Cfap44 UTSW 16 44451684 missense probably benign 0.31
R2233:Cfap44 UTSW 16 44451525 missense probably benign 0.01
R2439:Cfap44 UTSW 16 44481246 unclassified probably benign
R3015:Cfap44 UTSW 16 44410469 missense probably benign 0.40
R4178:Cfap44 UTSW 16 44451853 missense possibly damaging 0.81
R4421:Cfap44 UTSW 16 44422437 missense probably damaging 1.00
R4516:Cfap44 UTSW 16 44473864 nonsense probably null
R4742:Cfap44 UTSW 16 44449252 intron probably null
R4766:Cfap44 UTSW 16 44415883 splice site probably null
R4810:Cfap44 UTSW 16 44451535 missense probably damaging 0.99
R4955:Cfap44 UTSW 16 44475277 missense possibly damaging 0.75
R5058:Cfap44 UTSW 16 44420204 splice site probably null
R5172:Cfap44 UTSW 16 44449193 missense probably benign
R5344:Cfap44 UTSW 16 44416400 critical splice donor site probably null
R5519:Cfap44 UTSW 16 44404088 missense probably damaging 1.00
R5572:Cfap44 UTSW 16 44481305 missense possibly damaging 0.95
R5601:Cfap44 UTSW 16 44460186 missense probably damaging 1.00
R5625:Cfap44 UTSW 16 44460347 unclassified probably null
R5638:Cfap44 UTSW 16 44455531 missense possibly damaging 0.94
R5727:Cfap44 UTSW 16 44435442 missense probably damaging 0.98
R5950:Cfap44 UTSW 16 44479847 missense probably damaging 0.99
R6057:Cfap44 UTSW 16 44449097 missense probably benign 0.03
R6063:Cfap44 UTSW 16 44429892 missense probably benign 0.00
R6221:Cfap44 UTSW 16 44437186 missense probably benign 0.13
R6277:Cfap44 UTSW 16 44437306 missense probably benign 0.04
R6322:Cfap44 UTSW 16 44433666 nonsense probably null
R6836:Cfap44 UTSW 16 44404079 missense probably damaging 0.99
R6854:Cfap44 UTSW 16 44449028 critical splice acceptor site probably null
R6889:Cfap44 UTSW 16 44404132 missense probably benign 0.03
R7233:Cfap44 UTSW 16 44422408 missense probably damaging 0.99
R7298:Cfap44 UTSW 16 44481412 missense probably benign 0.04
R7332:Cfap44 UTSW 16 44429828 missense probably damaging 1.00
R7410:Cfap44 UTSW 16 44468413 missense probably damaging 1.00
R7456:Cfap44 UTSW 16 44431942 missense probably benign 0.07
R7491:Cfap44 UTSW 16 44470748 missense probably damaging 1.00
V1662:Cfap44 UTSW 16 44449138 nonsense probably null
X0060:Cfap44 UTSW 16 44449074 missense possibly damaging 0.83
Z1088:Cfap44 UTSW 16 44401466 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACGTGTTTTAAGCGTGAGG -3'
(R):5'- TATTAAGTCACGGGGCAGGAC -3'

Sequencing Primer
(F):5'- GGCTTTAGCGGATGTGTAAAAAG -3'
(R):5'- TAGATCGGTGAAGTCCAC -3'
Posted On2016-06-21