Incidental Mutation 'R5165:Synrg'
ID395662
Institutional Source Beutler Lab
Gene Symbol Synrg
Ensembl Gene ENSMUSG00000034940
Gene Namesynergin, gamma
SynonymsAp1gbp1, L71-5
MMRRC Submission 042746-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5165 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83964428-84044578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83990935 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 366 (S366P)
Ref Sequence ENSEMBL: ENSMUSP00000090510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049714] [ENSMUST00000092834] [ENSMUST00000183456] [ENSMUST00000183714]
Predicted Effect probably benign
Transcript: ENSMUST00000049714
AA Change: S445P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059000
Gene: ENSMUSG00000034940
AA Change: S445P

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
coiled coil region 113 153 N/A INTRINSIC
Blast:EH 301 368 8e-6 BLAST
low complexity region 560 569 N/A INTRINSIC
low complexity region 644 662 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1295 1306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092834
AA Change: S366P

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000090510
Gene: ENSMUSG00000034940
AA Change: S366P

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
Blast:EH 222 289 5e-6 BLAST
low complexity region 481 490 N/A INTRINSIC
low complexity region 565 583 N/A INTRINSIC
internal_repeat_1 617 755 7.57e-6 PROSPERO
internal_repeat_1 746 879 7.57e-6 PROSPERO
low complexity region 880 894 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138676
SMART Domains Protein: ENSMUSP00000117709
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Blast:EH 134 201 3e-7 BLAST
SCOP:d1fi6a_ 147 208 7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148901
Predicted Effect probably benign
Transcript: ENSMUST00000183456
AA Change: S545P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138969
Gene: ENSMUSG00000034940
AA Change: S545P

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
low complexity region 197 209 N/A INTRINSIC
Blast:EH 401 468 7e-6 BLAST
low complexity region 660 669 N/A INTRINSIC
low complexity region 744 762 N/A INTRINSIC
internal_repeat_1 796 934 2.26e-5 PROSPERO
internal_repeat_1 925 1058 2.26e-5 PROSPERO
low complexity region 1059 1073 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183714
AA Change: S444P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139103
Gene: ENSMUSG00000034940
AA Change: S444P

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
Blast:EH 300 367 6e-6 BLAST
low complexity region 559 568 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
internal_repeat_1 695 833 1.34e-5 PROSPERO
internal_repeat_1 824 957 1.34e-5 PROSPERO
low complexity region 958 972 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Meta Mutation Damage Score 0.1156 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the gamma subunit of AP1 clathrin-adaptor complex. The AP1 complex is located at the trans-Golgi network and associates specific proteins with clathrin-coated vesicles. This encoded protein may act to connect the AP1 complex to other proteins. Alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 T A 6: 83,526,832 I77F probably benign Het
Actl6a G A 3: 32,720,208 V285I probably benign Het
Adam9 A T 8: 24,967,174 I646N possibly damaging Het
Ahnak T C 19: 9,015,665 I4771T possibly damaging Het
Alas1 T C 9: 106,241,255 T223A probably damaging Het
Apc2 A G 10: 80,315,850 E2246G probably damaging Het
Atp1a1 A G 3: 101,581,789 I795T probably benign Het
Cdhr4 T C 9: 107,997,630 L633P probably damaging Het
Cep350 A G 1: 155,928,368 S990P probably damaging Het
Cplx2 A G 13: 54,378,976 I66V possibly damaging Het
Cx3cl1 T C 8: 94,779,876 S170P probably benign Het
Cyth1 T C 11: 118,169,082 N353S possibly damaging Het
Dapp1 T C 3: 137,939,215 probably null Het
Dmwd G A 7: 19,078,035 probably benign Het
Dsg1c A G 18: 20,277,023 H516R probably damaging Het
Efemp2 T C 19: 5,475,411 C39R probably damaging Het
Fnbp4 C G 2: 90,777,657 Q908E possibly damaging Het
Foxred2 A G 15: 77,956,012 V26A probably damaging Het
Gkap1 A G 13: 58,263,196 probably null Het
Gstcd A C 3: 133,084,679 V109G probably damaging Het
Hoxc9 T A 15: 102,984,000 M215K probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnj9 A T 1: 172,323,157 D296E probably benign Het
Kctd18 T C 1: 57,959,236 Y68C probably damaging Het
Kif21a A T 15: 90,956,376 M1179K probably benign Het
Lrfn5 T C 12: 61,839,624 I66T possibly damaging Het
Lrp12 A G 15: 39,872,461 S692P probably benign Het
Lrrc10 A T 10: 117,046,060 N213I probably benign Het
Mettl11b A G 1: 163,722,523 I53T probably benign Het
Nceh1 G A 3: 27,241,528 V313I probably benign Het
Nkx6-3 T A 8: 23,153,743 H53Q probably damaging Het
Nov A G 15: 54,749,189 D198G probably damaging Het
Olfr1276 T A 2: 111,257,223 V36E possibly damaging Het
Olfr128 A G 17: 37,924,361 D265G probably benign Het
Olfr1388 A G 11: 49,444,376 H175R probably damaging Het
Olfr1447 A T 19: 12,901,200 N193K probably benign Het
Oxct1 A T 15: 4,053,769 T157S possibly damaging Het
Pcdhga3 A G 18: 37,675,670 E392G possibly damaging Het
Polr1a T G 6: 71,967,925 Y1322D probably damaging Het
Prkdc T A 16: 15,678,272 S776T probably damaging Het
Ralgapb A G 2: 158,465,912 I1047V possibly damaging Het
Sertad4 A T 1: 192,846,822 S229T possibly damaging Het
Shank2 T A 7: 144,409,636 V327D possibly damaging Het
Skint6 A T 4: 112,865,668 V904E possibly damaging Het
Slfn8 A T 11: 83,017,127 Y197N probably damaging Het
Smo T A 6: 29,736,078 L23Q unknown Het
Snx29 T A 16: 11,420,775 M23K probably damaging Het
Tomm40 A G 7: 19,713,667 probably null Het
Tpcn1 T C 5: 120,557,945 E81G probably damaging Het
Trappc1 A G 11: 69,324,234 Q26R probably benign Het
Ttn T A 2: 76,776,556 probably null Het
Usp25 T A 16: 77,076,405 D450E possibly damaging Het
Zmynd19 T A 2: 24,958,189 Y132* probably null Het
Other mutations in Synrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Synrg APN 11 84039246 missense probably damaging 0.98
IGL01640:Synrg APN 11 83981508 missense probably damaging 1.00
IGL01936:Synrg APN 11 84019705 missense probably benign 0.00
IGL02311:Synrg APN 11 84019804 missense probably benign 0.01
IGL02836:Synrg APN 11 84001978 splice site probably benign
IGL02868:Synrg APN 11 83987050 splice site probably benign
IGL03185:Synrg APN 11 83981479 missense probably damaging 1.00
IGL03224:Synrg APN 11 84039666 missense possibly damaging 0.86
polaris UTSW 11 84019914 missense probably damaging 1.00
P0041:Synrg UTSW 11 83982311 splice site probably benign
R0023:Synrg UTSW 11 84008653 missense probably damaging 1.00
R0044:Synrg UTSW 11 84009181 missense probably damaging 1.00
R0082:Synrg UTSW 11 83987910 splice site probably benign
R0227:Synrg UTSW 11 84009432 missense probably damaging 1.00
R0361:Synrg UTSW 11 84024337 splice site probably null
R0494:Synrg UTSW 11 84019543 missense probably benign
R0548:Synrg UTSW 11 83982188 splice site probably benign
R0744:Synrg UTSW 11 84024305 nonsense probably null
R1114:Synrg UTSW 11 84023436 splice site probably benign
R1240:Synrg UTSW 11 84023356 missense probably damaging 1.00
R1989:Synrg UTSW 11 84019955 critical splice donor site probably null
R2247:Synrg UTSW 11 84009376 missense probably damaging 1.00
R2263:Synrg UTSW 11 83977152 missense possibly damaging 0.79
R2420:Synrg UTSW 11 84009224 missense probably damaging 0.96
R2421:Synrg UTSW 11 84009224 missense probably damaging 0.96
R2937:Synrg UTSW 11 83994354 missense probably damaging 1.00
R3783:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3784:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3785:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3787:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3925:Synrg UTSW 11 84040899 missense probably benign 0.03
R3945:Synrg UTSW 11 84023406 missense probably damaging 1.00
R3950:Synrg UTSW 11 83989815 missense probably damaging 1.00
R5216:Synrg UTSW 11 83982196 missense probably damaging 0.99
R5293:Synrg UTSW 11 83981499 missense probably damaging 1.00
R5561:Synrg UTSW 11 84002240 splice site probably null
R5575:Synrg UTSW 11 84009552 critical splice donor site probably null
R6079:Synrg UTSW 11 84024300 missense probably damaging 1.00
R6085:Synrg UTSW 11 84039661 missense possibly damaging 0.80
R6138:Synrg UTSW 11 84024300 missense probably damaging 1.00
R6259:Synrg UTSW 11 84008658 missense probably damaging 1.00
R6751:Synrg UTSW 11 83981425 missense probably damaging 1.00
R6795:Synrg UTSW 11 84019914 missense probably damaging 1.00
R6944:Synrg UTSW 11 84025086 missense probably damaging 1.00
R7092:Synrg UTSW 11 84008857 missense possibly damaging 0.95
R7109:Synrg UTSW 11 84039672 missense possibly damaging 0.82
R7291:Synrg UTSW 11 84009381 missense probably damaging 1.00
R7489:Synrg UTSW 11 83990825 missense probably benign 0.33
U15987:Synrg UTSW 11 84024300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTTTGAGCCAGTTCCC -3'
(R):5'- CTGGGGTCAAATTTAGGATCCTGAG -3'

Sequencing Primer
(F):5'- TACCTTAAGCGGCTTTCCTATGAC -3'
(R):5'- ATCCTGAGTATCCTAGTGAGAGCTC -3'
Posted On2016-06-21