Incidental Mutation 'R5039:4921501E09Rik'
List |< first << previous [record 64 of 10171] next >> last >|
ID395728
Institutional Source Beutler Lab
Gene Symbol 4921501E09Rik
Ensembl Gene ENSMUSG00000023350
Gene NameRIKEN cDNA 4921501E09 gene
Synonyms
MMRRC Submission 042629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R5039 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33064143-33068058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 33067760 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 23 (C23G)
Ref Sequence ENSEMBL: ENSMUSP00000024121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024121]
Predicted Effect probably damaging
Transcript: ENSMUST00000024121
AA Change: C23G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024121
Gene: ENSMUSG00000023350
AA Change: C23G

DomainStartEndE-ValueType
PHD 7 54 1.5e-8 SMART
JmjC 195 351 1.38e-46 SMART
low complexity region 475 489 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
Meta Mutation Damage Score 0.4896 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 G A 9: 44,281,566 A161V probably damaging Het
Anapc2 T C 2: 25,274,796 I64T possibly damaging Het
Arfgef1 T C 1: 10,199,736 D396G probably benign Het
Axl C T 7: 25,785,915 V163M probably damaging Het
Blm G A 7: 80,505,873 P353S possibly damaging Het
Btaf1 T C 19: 36,990,762 Y1116H probably benign Het
Ccdc18 T A 5: 108,158,648 probably null Het
Ccdc87 T C 19: 4,840,401 probably null Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ctr9 C A 7: 111,042,857 H297Q probably benign Het
Cyp2c55 A G 19: 39,038,143 D398G probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnmt3l T C 10: 78,052,900 probably null Het
Dock4 C A 12: 40,817,746 N1440K probably damaging Het
Etnk1 T A 6: 143,195,317 probably null Het
Fam120a A T 13: 48,910,250 probably null Het
Fanca T C 8: 123,284,046 D908G probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3633 A C 14: 42,639,204 N42K possibly damaging Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gpr139 A G 7: 119,144,942 V140A probably benign Het
Ighv1-62-3 G T 12: 115,461,394 T13K probably benign Het
Itgb2l T C 16: 96,425,005 T629A possibly damaging Het
Kcnb2 T C 1: 15,709,500 S199P probably damaging Het
Kdm1b G A 13: 47,077,486 G663D probably damaging Het
Lama1 A G 17: 67,745,893 D407G possibly damaging Het
Macf1 T C 4: 123,511,220 K391R probably damaging Het
Magi3 A T 3: 104,105,791 S127T probably damaging Het
Map2 A T 1: 66,438,796 D1759V probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myrfl T C 10: 116,822,711 D447G probably damaging Het
Ndufb7 A G 8: 83,571,465 probably benign Het
Nt5e T A 9: 88,363,581 N301K probably benign Het
Olfr944 T A 9: 39,218,114 Y252* probably null Het
Olfr960 A T 9: 39,623,560 T146S possibly damaging Het
Pcdh10 A G 3: 45,381,861 N870S probably damaging Het
Pcdh18 A G 3: 49,754,856 V670A probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ric3 G C 7: 109,038,723 S274R probably benign Het
Rimbp3 A G 16: 17,213,331 T1540A probably damaging Het
Rnf165 A G 18: 77,462,912 S107P probably damaging Het
Rp1l1 A T 14: 64,031,356 M1464L probably benign Het
Slc41a3 A G 6: 90,626,417 Y140C probably damaging Het
Ssb A T 2: 69,866,237 E38D possibly damaging Het
Syt14 A T 1: 193,026,984 I16N probably damaging Het
Tet3 T C 6: 83,375,896 T973A probably damaging Het
Tial1 T C 7: 128,443,968 probably benign Het
Tnfrsf1a A G 6: 125,360,712 T89A possibly damaging Het
Trpv5 T C 6: 41,675,945 Y98C possibly damaging Het
Ylpm1 T A 12: 85,015,493 S265T probably damaging Het
Ylpm1 A G 12: 85,042,239 D1006G probably damaging Het
Other mutations in 4921501E09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:4921501E09Rik APN 17 33065863 missense probably benign 0.10
IGL00790:4921501E09Rik APN 17 33067387 missense probably damaging 1.00
IGL01146:4921501E09Rik APN 17 33065383 missense possibly damaging 0.68
IGL01755:4921501E09Rik APN 17 33066977 missense probably damaging 0.99
IGL01880:4921501E09Rik APN 17 33066716 missense probably damaging 0.99
IGL01981:4921501E09Rik APN 17 33067654 missense probably damaging 1.00
IGL01982:4921501E09Rik APN 17 33066315 missense probably benign 0.00
IGL02047:4921501E09Rik APN 17 33067301 missense probably damaging 1.00
IGL02070:4921501E09Rik APN 17 33066130 missense probably damaging 0.98
R0055:4921501E09Rik UTSW 17 33066722 missense probably damaging 1.00
R0055:4921501E09Rik UTSW 17 33066722 missense probably damaging 1.00
R0893:4921501E09Rik UTSW 17 33065289 missense probably benign 0.34
R1528:4921501E09Rik UTSW 17 33067241 missense probably damaging 1.00
R1558:4921501E09Rik UTSW 17 33065705 missense probably benign 0.20
R1664:4921501E09Rik UTSW 17 33066518 missense probably damaging 1.00
R1782:4921501E09Rik UTSW 17 33067688 missense probably benign 0.06
R1881:4921501E09Rik UTSW 17 33065284 missense probably damaging 1.00
R2018:4921501E09Rik UTSW 17 33066967 missense probably benign 0.15
R2029:4921501E09Rik UTSW 17 33067624 nonsense probably null
R2152:4921501E09Rik UTSW 17 33066934 missense probably damaging 1.00
R2298:4921501E09Rik UTSW 17 33066778 missense probably damaging 1.00
R2395:4921501E09Rik UTSW 17 33065962 missense probably benign 0.28
R2424:4921501E09Rik UTSW 17 33065756 missense probably benign 0.00
R3973:4921501E09Rik UTSW 17 33066431 missense probably benign 0.24
R3976:4921501E09Rik UTSW 17 33066431 missense probably benign 0.24
R4159:4921501E09Rik UTSW 17 33066049 missense probably benign 0.01
R4160:4921501E09Rik UTSW 17 33066049 missense probably benign 0.01
R4161:4921501E09Rik UTSW 17 33066049 missense probably benign 0.01
R4761:4921501E09Rik UTSW 17 33067198 missense probably damaging 1.00
R4855:4921501E09Rik UTSW 17 33066739 missense probably benign 0.00
R5255:4921501E09Rik UTSW 17 33066765 nonsense probably null
R5383:4921501E09Rik UTSW 17 33065257 missense probably benign
R5520:4921501E09Rik UTSW 17 33065393 missense probably benign 0.03
R5588:4921501E09Rik UTSW 17 33066275 nonsense probably null
R5685:4921501E09Rik UTSW 17 33066772 missense probably benign 0.04
R5826:4921501E09Rik UTSW 17 33065314 missense possibly damaging 0.87
R5907:4921501E09Rik UTSW 17 33066150 missense probably benign 0.01
R6397:4921501E09Rik UTSW 17 33066245 missense probably benign 0.28
R6731:4921501E09Rik UTSW 17 33066226 missense probably benign 0.02
R6750:4921501E09Rik UTSW 17 33066398 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AATAGAGGTAGGGCTCCCAGTC -3'
(R):5'- GGTCAAAGTAAGTGGCCTGTG -3'

Sequencing Primer
(F):5'- TAGGGCTCCCAGTCATCAATG -3'
(R):5'- GCCTGTGAAGGGCTCAAAG -3'
Posted On2016-06-21