Incidental Mutation 'R5095:Prss56'
ID395799
Institutional Source Beutler Lab
Gene Symbol Prss56
Ensembl Gene ENSMUSG00000036480
Gene Nameprotease, serine 56
SynonymsPrss56, 1700027L20Rik
MMRRC Submission 042684-MU
Accession Numbers

Genbank: XM_487606

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5095 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87183313-87188405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 87188111 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 569 (R569P)
Ref Sequence ENSEMBL: ENSMUSP00000138773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044533] [ENSMUST00000073252] [ENSMUST00000186373]
Predicted Effect probably damaging
Transcript: ENSMUST00000044533
AA Change: R569P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138773
Gene: ENSMUSG00000036480
AA Change: R569P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Tryp_SPc 58 103 1e-5 BLAST
Tryp_SPc 108 336 1.17e-84 SMART
Blast:Tryp_SPc 340 385 4e-9 BLAST
low complexity region 386 407 N/A INTRINSIC
low complexity region 410 422 N/A INTRINSIC
Blast:Tryp_SPc 432 499 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000073252
SMART Domains Protein: ENSMUSP00000072983
Gene: ENSMUSG00000026251

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:Neur_chan_LBD 28 249 4.4e-70 PFAM
Pfam:Neur_chan_memb 256 492 1.1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186373
SMART Domains Protein: ENSMUSP00000139537
Gene: ENSMUSG00000026251

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 1 140 4.2e-40 PFAM
Pfam:Neur_chan_memb 147 383 6.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189970
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a peptidase S1 domain and possesses trypsin-like serine protease activity. The encoded protein may play a role in eye development, and mutations in this gene are a cause of autosomal recessive posterior microphthalmos. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for an ENU induced mutation show increased intraocular pressure, variable decreases in eye axial length, and narrow iridocorneal angles. Homozygous mice model angle-closure glaucoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik G C 10: 21,425,593 noncoding transcript Het
4932415D10Rik G T 10: 82,283,667 A4503E probably damaging Het
Adgrv1 C T 13: 81,095,487 V6265I probably benign Het
Agbl1 G A 7: 76,720,133 G660D probably damaging Het
Arap2 A G 5: 62,654,049 Y1140H probably damaging Het
Atp6v1c1 T C 15: 38,679,413 probably null Het
C1rb A T 6: 124,580,313 R470W possibly damaging Het
Caskin2 T C 11: 115,800,738 T1074A probably benign Het
Cdh19 T A 1: 110,954,661 T34S probably benign Het
Csnk1a1 T A 18: 61,575,476 Y175N probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Flt4 T A 11: 49,627,159 V342D possibly damaging Het
Frmd5 A T 2: 121,548,921 C394S possibly damaging Het
Gm5414 T G 15: 101,624,038 N550T probably benign Het
Hcn3 C A 3: 89,149,923 R456L probably damaging Het
Htt T C 5: 34,824,395 V893A possibly damaging Het
Ift46 A G 9: 44,786,849 D203G probably damaging Het
Itga10 G T 3: 96,648,164 V145L probably benign Het
Kcnh6 A G 11: 106,017,254 D232G possibly damaging Het
Mbtd1 T C 11: 93,929,671 S431P probably damaging Het
Mmp27 T A 9: 7,572,158 W120R probably damaging Het
Mmp27 A T 9: 7,579,000 D418V probably damaging Het
Myo5a A G 9: 75,152,020 D510G probably damaging Het
Myo5a A T 9: 75,184,389 K1179* probably null Het
Neto1 T C 18: 86,398,281 S38P probably benign Het
Nos3 A G 5: 24,368,918 probably benign Het
Nuggc C T 14: 65,635,090 R512* probably null Het
Oas1e T A 5: 120,794,264 K105* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr512 T C 7: 108,713,812 F141S probably damaging Het
Omd T A 13: 49,589,698 S75T possibly damaging Het
Pbrm1 A G 14: 31,032,530 N190S probably benign Het
Picalm T C 7: 90,170,633 F85L probably damaging Het
Polg A G 7: 79,460,300 V360A possibly damaging Het
Prex1 T C 2: 166,581,921 D1017G probably damaging Het
Rab6b G A 9: 103,140,384 G25R probably damaging Het
Rdh10 A G 1: 16,131,385 T332A probably benign Het
Rheb A T 5: 24,807,641 M115K probably benign Het
Rnf149 A T 1: 39,555,656 D321E probably benign Het
Rps28 C T 17: 33,823,203 probably null Het
Slc6a20b A G 9: 123,595,054 V616A probably benign Het
Smarcc2 A G 10: 128,469,300 K300R probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Srp68 C T 11: 116,248,747 V459M probably damaging Het
Stxbp4 C T 11: 90,548,975 V346I probably benign Het
Syne2 A G 12: 75,952,826 D2331G probably damaging Het
Ttn A T 2: 76,734,192 Y28534N probably damaging Het
Usp44 A T 10: 93,846,845 I386F possibly damaging Het
Vmn2r15 T C 5: 109,288,451 probably null Het
Vmn2r72 T A 7: 85,737,853 L834F probably damaging Het
Vps13b T A 15: 35,923,202 I3741K probably damaging Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Zfp607b T A 7: 27,693,636 probably benign Het
Other mutations in Prss56
AlleleSourceChrCoordTypePredicted EffectPPH Score
B5639:Prss56 UTSW 1 87187170 missense probably benign
R0390:Prss56 UTSW 1 87184730 intron probably null
R4544:Prss56 UTSW 1 87184642 missense probably damaging 0.99
R4723:Prss56 UTSW 1 87185337 missense possibly damaging 0.54
R4749:Prss56 UTSW 1 87185583 missense possibly damaging 0.88
R4898:Prss56 UTSW 1 87187986 missense probably damaging 0.99
R5176:Prss56 UTSW 1 87184158 missense probably damaging 1.00
R5205:Prss56 UTSW 1 87185534 missense probably damaging 1.00
R6029:Prss56 UTSW 1 87187557 nonsense probably null
R6223:Prss56 UTSW 1 87185412 missense probably benign 0.02
R7018:Prss56 UTSW 1 87185948 missense possibly damaging 0.54
R7143:Prss56 UTSW 1 87188153 missense probably benign
R7237:Prss56 UTSW 1 87184915 missense probably damaging 0.99
R7284:Prss56 UTSW 1 87185401 missense probably null 0.06
R7553:Prss56 UTSW 1 87183539 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCAGAAACCCTCAGGAGTGG -3'
(R):5'- TAGAGAGACTTTGTATGTCTCACAC -3'

Sequencing Primer
(F):5'- AACCTCCTCCCTCTGCAGG -3'
(R):5'- GAGACTTTGTATGTCTCACACAACCG -3'
Posted On2016-06-21