Incidental Mutation 'R5095:Cdh19'
ID395800
Institutional Source Beutler Lab
Gene Symbol Cdh19
Ensembl Gene ENSMUSG00000047216
Gene Namecadherin 19, type 2
Synonyms
MMRRC Submission 042684-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5095 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location110888326-110977584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110954661 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 34 (T34S)
Ref Sequence ENSEMBL: ENSMUSP00000092210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094626]
Predicted Effect probably benign
Transcript: ENSMUST00000094626
AA Change: T34S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092210
Gene: ENSMUSG00000047216
AA Change: T34S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 64 144 2.44e-14 SMART
CA 168 252 3.21e-23 SMART
CA 276 367 6.2e-7 SMART
CA 390 466 2.69e-16 SMART
CA 489 576 6.68e-3 SMART
transmembrane domain 594 616 N/A INTRINSIC
Pfam:Cadherin_C 619 764 1.7e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194910
Meta Mutation Damage Score 0.1652 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related type II cadherin genes situated in a cluster on chromosome 18. The encoded protein is a calcium dependent cell-cell adhesion glycoprotein containing five extracellular cadherin repeats. Loss of cadherins may be associated with cancer formation. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik G C 10: 21,425,593 noncoding transcript Het
4932415D10Rik G T 10: 82,283,667 A4503E probably damaging Het
Adgrv1 C T 13: 81,095,487 V6265I probably benign Het
Agbl1 G A 7: 76,720,133 G660D probably damaging Het
Arap2 A G 5: 62,654,049 Y1140H probably damaging Het
Atp6v1c1 T C 15: 38,679,413 probably null Het
C1rb A T 6: 124,580,313 R470W possibly damaging Het
Caskin2 T C 11: 115,800,738 T1074A probably benign Het
Csnk1a1 T A 18: 61,575,476 Y175N probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Flt4 T A 11: 49,627,159 V342D possibly damaging Het
Frmd5 A T 2: 121,548,921 C394S possibly damaging Het
Gm5414 T G 15: 101,624,038 N550T probably benign Het
Hcn3 C A 3: 89,149,923 R456L probably damaging Het
Htt T C 5: 34,824,395 V893A possibly damaging Het
Ift46 A G 9: 44,786,849 D203G probably damaging Het
Itga10 G T 3: 96,648,164 V145L probably benign Het
Kcnh6 A G 11: 106,017,254 D232G possibly damaging Het
Mbtd1 T C 11: 93,929,671 S431P probably damaging Het
Mmp27 T A 9: 7,572,158 W120R probably damaging Het
Mmp27 A T 9: 7,579,000 D418V probably damaging Het
Myo5a A G 9: 75,152,020 D510G probably damaging Het
Myo5a A T 9: 75,184,389 K1179* probably null Het
Neto1 T C 18: 86,398,281 S38P probably benign Het
Nos3 A G 5: 24,368,918 probably benign Het
Nuggc C T 14: 65,635,090 R512* probably null Het
Oas1e T A 5: 120,794,264 K105* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr512 T C 7: 108,713,812 F141S probably damaging Het
Omd T A 13: 49,589,698 S75T possibly damaging Het
Pbrm1 A G 14: 31,032,530 N190S probably benign Het
Picalm T C 7: 90,170,633 F85L probably damaging Het
Polg A G 7: 79,460,300 V360A possibly damaging Het
Prex1 T C 2: 166,581,921 D1017G probably damaging Het
Prss56 G C 1: 87,188,111 R569P probably damaging Het
Rab6b G A 9: 103,140,384 G25R probably damaging Het
Rdh10 A G 1: 16,131,385 T332A probably benign Het
Rheb A T 5: 24,807,641 M115K probably benign Het
Rnf149 A T 1: 39,555,656 D321E probably benign Het
Rps28 C T 17: 33,823,203 probably null Het
Slc6a20b A G 9: 123,595,054 V616A probably benign Het
Smarcc2 A G 10: 128,469,300 K300R probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Srp68 C T 11: 116,248,747 V459M probably damaging Het
Stxbp4 C T 11: 90,548,975 V346I probably benign Het
Syne2 A G 12: 75,952,826 D2331G probably damaging Het
Ttn A T 2: 76,734,192 Y28534N probably damaging Het
Usp44 A T 10: 93,846,845 I386F possibly damaging Het
Vmn2r15 T C 5: 109,288,451 probably null Het
Vmn2r72 T A 7: 85,737,853 L834F probably damaging Het
Vps13b T A 15: 35,923,202 I3741K probably damaging Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Zfp607b T A 7: 27,693,636 probably benign Het
Other mutations in Cdh19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Cdh19 APN 1 110949252 missense probably damaging 1.00
IGL00863:Cdh19 APN 1 110949144 missense probably damaging 1.00
IGL01537:Cdh19 APN 1 110919611 missense possibly damaging 0.73
IGL02108:Cdh19 APN 1 110889731 missense probably benign 0.31
IGL02125:Cdh19 APN 1 110929884 missense possibly damaging 0.94
IGL02234:Cdh19 APN 1 110932226 missense probably damaging 1.00
IGL02251:Cdh19 APN 1 110954652 missense probably benign 0.00
IGL02275:Cdh19 APN 1 110925886 missense probably benign 0.21
IGL03203:Cdh19 APN 1 110890098 missense possibly damaging 0.82
R0539:Cdh19 UTSW 1 110925162 missense possibly damaging 0.81
R0594:Cdh19 UTSW 1 110925867 missense probably benign 0.40
R0612:Cdh19 UTSW 1 110893170 splice site probably benign
R1028:Cdh19 UTSW 1 110954584 missense probably benign 0.03
R1627:Cdh19 UTSW 1 110919645 missense probably benign 0.16
R1728:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1729:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1730:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1739:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1762:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1783:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1785:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1974:Cdh19 UTSW 1 110890159 missense possibly damaging 0.50
R2119:Cdh19 UTSW 1 110919590 missense probably benign 0.00
R3026:Cdh19 UTSW 1 110954688 missense probably benign 0.03
R3037:Cdh19 UTSW 1 110954607 missense probably damaging 1.00
R3612:Cdh19 UTSW 1 110893296 missense probably damaging 1.00
R4254:Cdh19 UTSW 1 110925030 missense probably damaging 1.00
R4368:Cdh19 UTSW 1 110889712 nonsense probably null
R4624:Cdh19 UTSW 1 110932251 missense probably benign 0.25
R4648:Cdh19 UTSW 1 110925177 missense probably benign 0.04
R4720:Cdh19 UTSW 1 110895381 critical splice donor site probably null
R4766:Cdh19 UTSW 1 110893260 missense probably benign 0.39
R4937:Cdh19 UTSW 1 110889964 missense probably damaging 1.00
R4968:Cdh19 UTSW 1 110925228 missense probably benign 0.08
R4970:Cdh19 UTSW 1 110954624 missense possibly damaging 0.68
R5112:Cdh19 UTSW 1 110954624 missense possibly damaging 0.68
R5586:Cdh19 UTSW 1 110929857 missense probably damaging 1.00
R6431:Cdh19 UTSW 1 110925057 missense probably benign 0.00
R6595:Cdh19 UTSW 1 110925787 missense probably benign 0.15
R6997:Cdh19 UTSW 1 110954866 start gained probably benign
R7240:Cdh19 UTSW 1 110893407 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGAAATCATCAGACTTTCCAAACC -3'
(R):5'- TTCCCACATTTTAGGAACATACAGG -3'

Sequencing Primer
(F):5'- TCAGACTTTCCAAACCAACTCACTTC -3'
(R):5'- TACAGGAGAATTGAGAAACAAACAC -3'
Posted On2016-06-21