Incidental Mutation 'R5095:Rheb'
ID395809
Institutional Source Beutler Lab
Gene Symbol Rheb
Ensembl Gene ENSMUSG00000028945
Gene NameRas homolog enriched in brain
SynonymsRheb1
MMRRC Submission 042684-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5095 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24802823-24842624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24807641 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 115 (M115K)
Ref Sequence ENSEMBL: ENSMUSP00000030787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030787]
PDB Structure
Structure of Wild Type Mus musculus Rheb bound to GTP [X-RAY DIFFRACTION]
Structure of Mus musculus Rheb G63A mutant bound to GTP [X-RAY DIFFRACTION]
Structure of Mus musculus Rheb G63V mutant bound to GDP [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030787
AA Change: M115K

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030787
Gene: ENSMUSG00000028945
AA Change: M115K

DomainStartEndE-ValueType
RAS 4 170 3.78e-88 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154523
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the small GTPase superfamily and encodes a lipid-anchored, cell membrane protein with five repeats of the RAS-related GTP-binding region. This protein is vital in regulation of growth and cell cycle progression due to its role in the insulin/TOR/S6K signaling pathway. The protein has GTPase activity and shuttles between a GDP-bound form and a GTP-bound form, and farnesylation of the protein is required for this activity. Three pseudogenes have been mapped, two on chromosome 10 and one on chromosome 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display embryonic lethality during organogenesis associated with impaired heart development. Mice homozygous for a conditional allele activated in the heart exhibit postnatal lethality due to impaired cardiac hypertrophic growth and sarcomere maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik G C 10: 21,425,593 noncoding transcript Het
4932415D10Rik G T 10: 82,283,667 A4503E probably damaging Het
Adgrv1 C T 13: 81,095,487 V6265I probably benign Het
Agbl1 G A 7: 76,720,133 G660D probably damaging Het
Arap2 A G 5: 62,654,049 Y1140H probably damaging Het
Atp6v1c1 T C 15: 38,679,413 probably null Het
C1rb A T 6: 124,580,313 R470W possibly damaging Het
Caskin2 T C 11: 115,800,738 T1074A probably benign Het
Cdh19 T A 1: 110,954,661 T34S probably benign Het
Csnk1a1 T A 18: 61,575,476 Y175N probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Flt4 T A 11: 49,627,159 V342D possibly damaging Het
Frmd5 A T 2: 121,548,921 C394S possibly damaging Het
Gm5414 T G 15: 101,624,038 N550T probably benign Het
Hcn3 C A 3: 89,149,923 R456L probably damaging Het
Htt T C 5: 34,824,395 V893A possibly damaging Het
Ift46 A G 9: 44,786,849 D203G probably damaging Het
Itga10 G T 3: 96,648,164 V145L probably benign Het
Kcnh6 A G 11: 106,017,254 D232G possibly damaging Het
Mbtd1 T C 11: 93,929,671 S431P probably damaging Het
Mmp27 T A 9: 7,572,158 W120R probably damaging Het
Mmp27 A T 9: 7,579,000 D418V probably damaging Het
Myo5a A G 9: 75,152,020 D510G probably damaging Het
Myo5a A T 9: 75,184,389 K1179* probably null Het
Neto1 T C 18: 86,398,281 S38P probably benign Het
Nos3 A G 5: 24,368,918 probably benign Het
Nuggc C T 14: 65,635,090 R512* probably null Het
Oas1e T A 5: 120,794,264 K105* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr512 T C 7: 108,713,812 F141S probably damaging Het
Omd T A 13: 49,589,698 S75T possibly damaging Het
Pbrm1 A G 14: 31,032,530 N190S probably benign Het
Picalm T C 7: 90,170,633 F85L probably damaging Het
Polg A G 7: 79,460,300 V360A possibly damaging Het
Prex1 T C 2: 166,581,921 D1017G probably damaging Het
Prss56 G C 1: 87,188,111 R569P probably damaging Het
Rab6b G A 9: 103,140,384 G25R probably damaging Het
Rdh10 A G 1: 16,131,385 T332A probably benign Het
Rnf149 A T 1: 39,555,656 D321E probably benign Het
Rps28 C T 17: 33,823,203 probably null Het
Slc6a20b A G 9: 123,595,054 V616A probably benign Het
Smarcc2 A G 10: 128,469,300 K300R probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Srp68 C T 11: 116,248,747 V459M probably damaging Het
Stxbp4 C T 11: 90,548,975 V346I probably benign Het
Syne2 A G 12: 75,952,826 D2331G probably damaging Het
Ttn A T 2: 76,734,192 Y28534N probably damaging Het
Usp44 A T 10: 93,846,845 I386F possibly damaging Het
Vmn2r15 T C 5: 109,288,451 probably null Het
Vmn2r72 T A 7: 85,737,853 L834F probably damaging Het
Vps13b T A 15: 35,923,202 I3741K probably damaging Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Zfp607b T A 7: 27,693,636 probably benign Het
Other mutations in Rheb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Rheb APN 5 24807075 missense probably damaging 1.00
IGL02836:Rheb APN 5 24803711 missense probably benign 0.01
R0050:Rheb UTSW 5 24817834 splice site probably benign
R0050:Rheb UTSW 5 24817834 splice site probably benign
R2137:Rheb UTSW 5 24807603 critical splice donor site probably null
R3034:Rheb UTSW 5 24803723 missense probably damaging 0.97
R4949:Rheb UTSW 5 24803731 missense possibly damaging 0.75
R5259:Rheb UTSW 5 24803745 missense probably benign
R5763:Rheb UTSW 5 24807787 missense probably benign 0.01
R5847:Rheb UTSW 5 24807069 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGTCCCCGTCAGGAGAATCTC -3'
(R):5'- CAGCCCCGTGATAGACTTTTG -3'

Sequencing Primer
(F):5'- GAGAATCTCTCAGTTTGCTACTTG -3'
(R):5'- AGCCCCGTGATAGACTTTTGCTAAG -3'
Posted On2016-06-21