Incidental Mutation 'R0450:Acoxl'
ID39581
Institutional Source Beutler Lab
Gene Symbol Acoxl
Ensembl Gene ENSMUSG00000027380
Gene Nameacyl-Coenzyme A oxidase-like
Synonyms1200014P05Rik
MMRRC Submission 038650-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0450 (G1)
Quality Score216
Status Not validated
Chromosome2
Chromosomal Location127838876-128123873 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 127880503 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028859]
Predicted Effect probably null
Transcript: ENSMUST00000028859
SMART Domains Protein: ENSMUSP00000028859
Gene: ENSMUSG00000027380

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 115 223 7.2e-19 PFAM
Pfam:Acyl-CoA_dh_1 254 416 1.8e-14 PFAM
Pfam:ACOX 458 599 6.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126410
Meta Mutation Damage Score 0.6212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI606181 A C 19: 41,593,731 K113N unknown Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Arih2 T A 9: 108,605,092 H490L possibly damaging Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Cep76 A T 18: 67,634,780 N227K probably benign Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Glipr1l2 A G 10: 112,092,572 D124G probably benign Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hnrnph3 T A 10: 63,018,215 R41S probably benign Het
Hnrnph3 T A 10: 63,019,500 D2V probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mospd3 A G 5: 137,597,032 L233P probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Stk11 T C 10: 80,126,086 V47A probably damaging Het
Tmpo A C 10: 91,163,096 I276M probably benign Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Upb1 T C 10: 75,415,083 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Acoxl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Acoxl APN 2 127978804 missense probably damaging 1.00
IGL01397:Acoxl APN 2 128034891 missense possibly damaging 0.67
IGL02502:Acoxl APN 2 128075884 missense probably damaging 1.00
P4748:Acoxl UTSW 2 128086344 splice site probably benign
R0469:Acoxl UTSW 2 127880503 splice site probably null
R0510:Acoxl UTSW 2 127880503 splice site probably null
R1257:Acoxl UTSW 2 128044366 missense probably benign 0.01
R1703:Acoxl UTSW 2 127978772 missense probably damaging 0.99
R1726:Acoxl UTSW 2 127880446 missense probably damaging 1.00
R1867:Acoxl UTSW 2 127877787 missense probably damaging 1.00
R2103:Acoxl UTSW 2 127972606 missense probably damaging 0.97
R2168:Acoxl UTSW 2 127878781 missense probably damaging 1.00
R2761:Acoxl UTSW 2 127877813 missense probably benign 0.01
R3895:Acoxl UTSW 2 127972525 splice site probably benign
R4370:Acoxl UTSW 2 127878788 missense possibly damaging 0.95
R4571:Acoxl UTSW 2 127877807 missense probably damaging 1.00
R4727:Acoxl UTSW 2 127978738 missense probably damaging 1.00
R4851:Acoxl UTSW 2 128044391 missense possibly damaging 0.62
R4962:Acoxl UTSW 2 128075890 missense probably damaging 0.98
R5248:Acoxl UTSW 2 128075935 critical splice donor site probably null
R5392:Acoxl UTSW 2 128010168 critical splice donor site probably null
R5411:Acoxl UTSW 2 127854901 missense probably benign 0.00
R5418:Acoxl UTSW 2 127877802 missense probably benign 0.34
R5507:Acoxl UTSW 2 127884474 missense probably damaging 0.99
R5681:Acoxl UTSW 2 127972639 missense possibly damaging 0.93
R5738:Acoxl UTSW 2 127877766 missense probably benign 0.21
R6325:Acoxl UTSW 2 128123024 missense probably benign 0.02
R6800:Acoxl UTSW 2 128010165 missense probably damaging 1.00
R7027:Acoxl UTSW 2 128010083 missense probably benign
R7098:Acoxl UTSW 2 127854915 nonsense probably null
R7165:Acoxl UTSW 2 128123108 missense probably benign
Z1088:Acoxl UTSW 2 127872195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGGGCTCCAAACAAGGAAAAC -3'
(R):5'- GAGCATTTAACCTTCTCTCTAGCGGC -3'

Sequencing Primer
(F):5'- AACTGACAGCATCCTTACTCTG -3'
(R):5'- AGCGGCTTATCTACCTTTTCCAG -3'
Posted On2013-05-23