Incidental Mutation 'R5095:Vmn2r15'
ID395813
Institutional Source Beutler Lab
Gene Symbol Vmn2r15
Ensembl Gene ENSMUSG00000091375
Gene Namevomeronasal 2, receptor 15
SynonymsEG211223
MMRRC Submission 042684-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R5095 (G1)
Quality Score181
Status Validated
Chromosome5
Chromosomal Location109286269-109297556 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 109288451 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167133] [ENSMUST00000167133] [ENSMUST00000167133]
Predicted Effect probably null
Transcript: ENSMUST00000167133
SMART Domains Protein: ENSMUSP00000128333
Gene: ENSMUSG00000091375

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 75 472 1e-29 PFAM
Pfam:NCD3G 514 568 5.8e-18 PFAM
Pfam:7tm_3 601 836 9.1e-55 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167133
SMART Domains Protein: ENSMUSP00000128333
Gene: ENSMUSG00000091375

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 75 472 1e-29 PFAM
Pfam:NCD3G 514 568 5.8e-18 PFAM
Pfam:7tm_3 601 836 9.1e-55 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167133
SMART Domains Protein: ENSMUSP00000128333
Gene: ENSMUSG00000091375

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 75 472 1e-29 PFAM
Pfam:NCD3G 514 568 5.8e-18 PFAM
Pfam:7tm_3 601 836 9.1e-55 PFAM
Meta Mutation Damage Score 0.6464 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik G C 10: 21,425,593 noncoding transcript Het
4932415D10Rik G T 10: 82,283,667 A4503E probably damaging Het
Adgrv1 C T 13: 81,095,487 V6265I probably benign Het
Agbl1 G A 7: 76,720,133 G660D probably damaging Het
Arap2 A G 5: 62,654,049 Y1140H probably damaging Het
Atp6v1c1 T C 15: 38,679,413 probably null Het
C1rb A T 6: 124,580,313 R470W possibly damaging Het
Caskin2 T C 11: 115,800,738 T1074A probably benign Het
Cdh19 T A 1: 110,954,661 T34S probably benign Het
Csnk1a1 T A 18: 61,575,476 Y175N probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Flt4 T A 11: 49,627,159 V342D possibly damaging Het
Frmd5 A T 2: 121,548,921 C394S possibly damaging Het
Gm5414 T G 15: 101,624,038 N550T probably benign Het
Hcn3 C A 3: 89,149,923 R456L probably damaging Het
Htt T C 5: 34,824,395 V893A possibly damaging Het
Ift46 A G 9: 44,786,849 D203G probably damaging Het
Itga10 G T 3: 96,648,164 V145L probably benign Het
Kcnh6 A G 11: 106,017,254 D232G possibly damaging Het
Mbtd1 T C 11: 93,929,671 S431P probably damaging Het
Mmp27 T A 9: 7,572,158 W120R probably damaging Het
Mmp27 A T 9: 7,579,000 D418V probably damaging Het
Myo5a A G 9: 75,152,020 D510G probably damaging Het
Myo5a A T 9: 75,184,389 K1179* probably null Het
Neto1 T C 18: 86,398,281 S38P probably benign Het
Nos3 A G 5: 24,368,918 probably benign Het
Nuggc C T 14: 65,635,090 R512* probably null Het
Oas1e T A 5: 120,794,264 K105* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr512 T C 7: 108,713,812 F141S probably damaging Het
Omd T A 13: 49,589,698 S75T possibly damaging Het
Pbrm1 A G 14: 31,032,530 N190S probably benign Het
Picalm T C 7: 90,170,633 F85L probably damaging Het
Polg A G 7: 79,460,300 V360A possibly damaging Het
Prex1 T C 2: 166,581,921 D1017G probably damaging Het
Prss56 G C 1: 87,188,111 R569P probably damaging Het
Rab6b G A 9: 103,140,384 G25R probably damaging Het
Rdh10 A G 1: 16,131,385 T332A probably benign Het
Rheb A T 5: 24,807,641 M115K probably benign Het
Rnf149 A T 1: 39,555,656 D321E probably benign Het
Rps28 C T 17: 33,823,203 probably null Het
Slc6a20b A G 9: 123,595,054 V616A probably benign Het
Smarcc2 A G 10: 128,469,300 K300R probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Srp68 C T 11: 116,248,747 V459M probably damaging Het
Stxbp4 C T 11: 90,548,975 V346I probably benign Het
Syne2 A G 12: 75,952,826 D2331G probably damaging Het
Ttn A T 2: 76,734,192 Y28534N probably damaging Het
Usp44 A T 10: 93,846,845 I386F possibly damaging Het
Vmn2r72 T A 7: 85,737,853 L834F probably damaging Het
Vps13b T A 15: 35,923,202 I3741K probably damaging Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Zfp607b T A 7: 27,693,636 probably benign Het
Other mutations in Vmn2r15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Vmn2r15 APN 5 109286736 missense possibly damaging 0.70
IGL01367:Vmn2r15 APN 5 109293209 missense probably damaging 0.99
IGL01844:Vmn2r15 APN 5 109286269 makesense probably null
IGL02190:Vmn2r15 APN 5 109293374 missense probably damaging 1.00
IGL02754:Vmn2r15 APN 5 109293268 nonsense probably null
IGL02797:Vmn2r15 APN 5 109297384 missense probably benign 0.18
IGL03301:Vmn2r15 APN 5 109297355 critical splice donor site probably null
IGL03407:Vmn2r15 APN 5 109286319 nonsense probably null
PIT4445001:Vmn2r15 UTSW 5 109287142 missense probably damaging 0.99
PIT4520001:Vmn2r15 UTSW 5 109287005 missense probably damaging 1.00
R0038:Vmn2r15 UTSW 5 109293144 missense possibly damaging 0.46
R0111:Vmn2r15 UTSW 5 109287156 missense possibly damaging 0.56
R0379:Vmn2r15 UTSW 5 109286478 missense probably damaging 1.00
R0427:Vmn2r15 UTSW 5 109287087 missense probably damaging 1.00
R0639:Vmn2r15 UTSW 5 109293015 missense probably benign 0.22
R0964:Vmn2r15 UTSW 5 109297535 missense probably benign 0.34
R1147:Vmn2r15 UTSW 5 109293206 missense probably damaging 1.00
R1147:Vmn2r15 UTSW 5 109293206 missense probably damaging 1.00
R1232:Vmn2r15 UTSW 5 109293302 missense probably benign 0.39
R1241:Vmn2r15 UTSW 5 109292904 missense probably damaging 1.00
R1244:Vmn2r15 UTSW 5 109293226 nonsense probably null
R1394:Vmn2r15 UTSW 5 109294148 missense probably benign 0.44
R1395:Vmn2r15 UTSW 5 109294148 missense probably benign 0.44
R1423:Vmn2r15 UTSW 5 109293227 missense probably damaging 1.00
R1439:Vmn2r15 UTSW 5 109294087 missense probably damaging 1.00
R1513:Vmn2r15 UTSW 5 109293329 missense probably damaging 1.00
R1777:Vmn2r15 UTSW 5 109294270 missense possibly damaging 0.79
R1844:Vmn2r15 UTSW 5 109286994 nonsense probably null
R2072:Vmn2r15 UTSW 5 109286753 missense possibly damaging 0.65
R2074:Vmn2r15 UTSW 5 109286753 missense possibly damaging 0.65
R2122:Vmn2r15 UTSW 5 109286456 missense probably damaging 1.00
R2208:Vmn2r15 UTSW 5 109297443 missense possibly damaging 0.64
R2268:Vmn2r15 UTSW 5 109293207 missense probably benign 0.31
R2831:Vmn2r15 UTSW 5 109286592 missense probably damaging 1.00
R3848:Vmn2r15 UTSW 5 109297446 missense probably benign 0.00
R4058:Vmn2r15 UTSW 5 109293446 missense probably damaging 0.99
R4615:Vmn2r15 UTSW 5 109293482 missense possibly damaging 0.91
R4663:Vmn2r15 UTSW 5 109294074 missense probably benign
R4681:Vmn2r15 UTSW 5 109286622 missense probably damaging 0.97
R4751:Vmn2r15 UTSW 5 109286754 missense probably benign 0.01
R5300:Vmn2r15 UTSW 5 109294108 missense probably damaging 0.99
R5309:Vmn2r15 UTSW 5 109293090 missense probably damaging 0.99
R5335:Vmn2r15 UTSW 5 109286807 missense probably damaging 0.99
R5421:Vmn2r15 UTSW 5 109286535 missense probably damaging 1.00
R5805:Vmn2r15 UTSW 5 109286940 missense possibly damaging 0.88
R6280:Vmn2r15 UTSW 5 109293425 missense possibly damaging 0.65
R6324:Vmn2r15 UTSW 5 109286271 makesense probably null
R6383:Vmn2r15 UTSW 5 109293226 nonsense probably null
R6772:Vmn2r15 UTSW 5 109286372 missense probably damaging 0.99
R6991:Vmn2r15 UTSW 5 109293314 missense probably damaging 1.00
R7194:Vmn2r15 UTSW 5 109292783 missense probably damaging 1.00
R7365:Vmn2r15 UTSW 5 109293239 missense probably benign 0.19
R7365:Vmn2r15 UTSW 5 109297522 missense probably benign 0.15
R7423:Vmn2r15 UTSW 5 109297528 missense probably benign 0.00
R7552:Vmn2r15 UTSW 5 109292908 nonsense probably null
X0065:Vmn2r15 UTSW 5 109293308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGACTTCAGTTTCCATCTAGGC -3'
(R):5'- ATGACATTCAGTGCATTGCATG -3'

Sequencing Primer
(F):5'- CTAGTTTGGAAAAAGAAGGCTTCTG -3'
(R):5'- CAGTGCATTGCATGATAATACAAAC -3'
Posted On2016-06-21