Incidental Mutation 'R5095:Atp6v1c1'
ID395846
Institutional Source Beutler Lab
Gene Symbol Atp6v1c1
Ensembl Gene ENSMUSG00000022295
Gene NameATPase, H+ transporting, lysosomal V1 subunit C1
Synonyms1700025B18Rik
MMRRC Submission 042684-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5095 (G1)
Quality Score221
Status Validated
Chromosome15
Chromosomal Location38661933-38692446 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 38679413 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022904] [ENSMUST00000226533]
Predicted Effect probably null
Transcript: ENSMUST00000022904
SMART Domains Protein: ENSMUSP00000022904
Gene: ENSMUSG00000022295

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 370 1.2e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226487
Predicted Effect probably benign
Transcript: ENSMUST00000226533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228486
Meta Mutation Damage Score 0.536 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene is one of two genes that encode the V1 domain C subunit proteins and is found ubiquitously. This C subunit is analogous but not homologous to gamma subunit of F-ATPases. Previously, this gene was designated ATP6D. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik G C 10: 21,425,593 noncoding transcript Het
4932415D10Rik G T 10: 82,283,667 A4503E probably damaging Het
Adgrv1 C T 13: 81,095,487 V6265I probably benign Het
Agbl1 G A 7: 76,720,133 G660D probably damaging Het
Arap2 A G 5: 62,654,049 Y1140H probably damaging Het
C1rb A T 6: 124,580,313 R470W possibly damaging Het
Caskin2 T C 11: 115,800,738 T1074A probably benign Het
Cdh19 T A 1: 110,954,661 T34S probably benign Het
Csnk1a1 T A 18: 61,575,476 Y175N probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Flt4 T A 11: 49,627,159 V342D possibly damaging Het
Frmd5 A T 2: 121,548,921 C394S possibly damaging Het
Gm5414 T G 15: 101,624,038 N550T probably benign Het
Hcn3 C A 3: 89,149,923 R456L probably damaging Het
Htt T C 5: 34,824,395 V893A possibly damaging Het
Ift46 A G 9: 44,786,849 D203G probably damaging Het
Itga10 G T 3: 96,648,164 V145L probably benign Het
Kcnh6 A G 11: 106,017,254 D232G possibly damaging Het
Mbtd1 T C 11: 93,929,671 S431P probably damaging Het
Mmp27 T A 9: 7,572,158 W120R probably damaging Het
Mmp27 A T 9: 7,579,000 D418V probably damaging Het
Myo5a A G 9: 75,152,020 D510G probably damaging Het
Myo5a A T 9: 75,184,389 K1179* probably null Het
Neto1 T C 18: 86,398,281 S38P probably benign Het
Nos3 A G 5: 24,368,918 probably benign Het
Nuggc C T 14: 65,635,090 R512* probably null Het
Oas1e T A 5: 120,794,264 K105* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr512 T C 7: 108,713,812 F141S probably damaging Het
Omd T A 13: 49,589,698 S75T possibly damaging Het
Pbrm1 A G 14: 31,032,530 N190S probably benign Het
Picalm T C 7: 90,170,633 F85L probably damaging Het
Polg A G 7: 79,460,300 V360A possibly damaging Het
Prex1 T C 2: 166,581,921 D1017G probably damaging Het
Prss56 G C 1: 87,188,111 R569P probably damaging Het
Rab6b G A 9: 103,140,384 G25R probably damaging Het
Rdh10 A G 1: 16,131,385 T332A probably benign Het
Rheb A T 5: 24,807,641 M115K probably benign Het
Rnf149 A T 1: 39,555,656 D321E probably benign Het
Rps28 C T 17: 33,823,203 probably null Het
Slc6a20b A G 9: 123,595,054 V616A probably benign Het
Smarcc2 A G 10: 128,469,300 K300R probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Srp68 C T 11: 116,248,747 V459M probably damaging Het
Stxbp4 C T 11: 90,548,975 V346I probably benign Het
Syne2 A G 12: 75,952,826 D2331G probably damaging Het
Ttn A T 2: 76,734,192 Y28534N probably damaging Het
Usp44 A T 10: 93,846,845 I386F possibly damaging Het
Vmn2r15 T C 5: 109,288,451 probably null Het
Vmn2r72 T A 7: 85,737,853 L834F probably damaging Het
Vps13b T A 15: 35,923,202 I3741K probably damaging Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Zfp607b T A 7: 27,693,636 probably benign Het
Other mutations in Atp6v1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Atp6v1c1 APN 15 38686856 missense probably damaging 0.99
IGL01371:Atp6v1c1 APN 15 38682960 missense probably benign
IGL02987:Atp6v1c1 APN 15 38690562 missense possibly damaging 0.70
P0029:Atp6v1c1 UTSW 15 38686902 unclassified probably benign
R0550:Atp6v1c1 UTSW 15 38682929 splice site probably benign
R0669:Atp6v1c1 UTSW 15 38677528 missense probably benign 0.00
R2033:Atp6v1c1 UTSW 15 38673966 critical splice donor site probably null
R3021:Atp6v1c1 UTSW 15 38689216 missense possibly damaging 0.75
R4475:Atp6v1c1 UTSW 15 38677573 missense probably benign 0.03
R4612:Atp6v1c1 UTSW 15 38677612 missense probably damaging 1.00
R4798:Atp6v1c1 UTSW 15 38689176 missense probably damaging 1.00
R5600:Atp6v1c1 UTSW 15 38686863 missense probably benign 0.17
R6177:Atp6v1c1 UTSW 15 38673928 nonsense probably null
R6434:Atp6v1c1 UTSW 15 38677546 missense probably damaging 0.99
R6916:Atp6v1c1 UTSW 15 38677581 missense probably benign 0.00
R6973:Atp6v1c1 UTSW 15 38690550 missense probably damaging 1.00
R7395:Atp6v1c1 UTSW 15 38691705 makesense probably null
Predicted Primers PCR Primer
(F):5'- GTAAATGAACTACGTGGACTAATGTA -3'
(R):5'- AGAAGTATTTTCCATGTGTGTACACG -3'

Sequencing Primer
(F):5'- ACAGGGTTTCTCCGTAAAGC -3'
(R):5'- CCGGATCACCTAGATATGAAGTTAC -3'
Posted On2016-06-21