Incidental Mutation 'R5095:Rps28'
ID395849
Institutional Source Beutler Lab
Gene Symbol Rps28
Ensembl Gene ENSMUSG00000067288
Gene Nameribosomal protein S28
Synonyms
MMRRC Submission 042684-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5095 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33819027-33824562 bp(-) (GRCm38)
Type of Mutationunclassified (286 bp from exon)
DNA Base Change (assembly) C to T at 33823203 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000048249] [ENSMUST00000048560] [ENSMUST00000087342] [ENSMUST00000166693] [ENSMUST00000172649] [ENSMUST00000173019] [ENSMUST00000173132] [ENSMUST00000173789] [ENSMUST00000173844] [ENSMUST00000173879]
Predicted Effect probably benign
Transcript: ENSMUST00000048249
SMART Domains Protein: ENSMUSP00000039692
Gene: ENSMUSG00000041881

DomainStartEndE-ValueType
Pfam:CI-B14_5a 5 102 2.1e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000048560
SMART Domains Protein: ENSMUSP00000040126
Gene: ENSMUSG00000042099

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:KN_motif 32 73 9.1e-24 PFAM
low complexity region 105 125 N/A INTRINSIC
low complexity region 138 150 N/A INTRINSIC
coiled coil region 180 229 N/A INTRINSIC
low complexity region 317 362 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
low complexity region 460 478 N/A INTRINSIC
low complexity region 485 498 N/A INTRINSIC
ANK 606 636 3.46e-4 SMART
ANK 640 674 2.88e2 SMART
ANK 679 708 5.41e-6 SMART
ANK 712 742 2.73e-2 SMART
Blast:ANK 746 775 4e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000087342
SMART Domains Protein: ENSMUSP00000110013
Gene: ENSMUSG00000067288

DomainStartEndE-ValueType
Pfam:Ribosomal_S28e 1 69 3.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166693
SMART Domains Protein: ENSMUSP00000133642
Gene: ENSMUSG00000067288

DomainStartEndE-ValueType
Pfam:Ribosomal_S28e 1 69 3.6e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172649
SMART Domains Protein: ENSMUSP00000133760
Gene: ENSMUSG00000042099

DomainStartEndE-ValueType
coiled coil region 8 41 N/A INTRINSIC
low complexity region 129 174 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 272 290 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
ANK 418 448 3.46e-4 SMART
ANK 452 486 2.88e2 SMART
ANK 491 520 5.41e-6 SMART
ANK 524 554 2.73e-2 SMART
Blast:ANK 558 587 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173019
SMART Domains Protein: ENSMUSP00000134615
Gene: ENSMUSG00000067288

DomainStartEndE-ValueType
Pfam:Ribosomal_S28e 1 69 3.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173649
Predicted Effect probably null
Transcript: ENSMUST00000173789
SMART Domains Protein: ENSMUSP00000133625
Gene: ENSMUSG00000042099

DomainStartEndE-ValueType
ANK 22 56 2.88e2 SMART
ANK 61 90 5.41e-6 SMART
ANK 94 124 2.73e-2 SMART
Blast:ANK 128 157 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173807
Predicted Effect probably benign
Transcript: ENSMUST00000173844
SMART Domains Protein: ENSMUSP00000133357
Gene: ENSMUSG00000067288

DomainStartEndE-ValueType
Pfam:Ribosomal_S28e 1 69 3.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173879
SMART Domains Protein: ENSMUSP00000134240
Gene: ENSMUSG00000067288

DomainStartEndE-ValueType
Pfam:Ribosomal_S28e 1 56 2.5e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174498
Predicted Effect probably null
Transcript: ENSMUST00000174608
SMART Domains Protein: ENSMUSP00000134656
Gene: ENSMUSG00000042099

DomainStartEndE-ValueType
SCOP:d1bd8__ 2 47 9e-5 SMART
PDB:4HBD|A 8 48 1e-6 PDB
Blast:ANK 23 52 3e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174788
Meta Mutation Damage Score 0.6368 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S28E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik G C 10: 21,425,593 noncoding transcript Het
4932415D10Rik G T 10: 82,283,667 A4503E probably damaging Het
Adgrv1 C T 13: 81,095,487 V6265I probably benign Het
Agbl1 G A 7: 76,720,133 G660D probably damaging Het
Arap2 A G 5: 62,654,049 Y1140H probably damaging Het
Atp6v1c1 T C 15: 38,679,413 probably null Het
C1rb A T 6: 124,580,313 R470W possibly damaging Het
Caskin2 T C 11: 115,800,738 T1074A probably benign Het
Cdh19 T A 1: 110,954,661 T34S probably benign Het
Csnk1a1 T A 18: 61,575,476 Y175N probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Flt4 T A 11: 49,627,159 V342D possibly damaging Het
Frmd5 A T 2: 121,548,921 C394S possibly damaging Het
Gm5414 T G 15: 101,624,038 N550T probably benign Het
Hcn3 C A 3: 89,149,923 R456L probably damaging Het
Htt T C 5: 34,824,395 V893A possibly damaging Het
Ift46 A G 9: 44,786,849 D203G probably damaging Het
Itga10 G T 3: 96,648,164 V145L probably benign Het
Kcnh6 A G 11: 106,017,254 D232G possibly damaging Het
Mbtd1 T C 11: 93,929,671 S431P probably damaging Het
Mmp27 T A 9: 7,572,158 W120R probably damaging Het
Mmp27 A T 9: 7,579,000 D418V probably damaging Het
Myo5a A G 9: 75,152,020 D510G probably damaging Het
Myo5a A T 9: 75,184,389 K1179* probably null Het
Neto1 T C 18: 86,398,281 S38P probably benign Het
Nos3 A G 5: 24,368,918 probably benign Het
Nuggc C T 14: 65,635,090 R512* probably null Het
Oas1e T A 5: 120,794,264 K105* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr512 T C 7: 108,713,812 F141S probably damaging Het
Omd T A 13: 49,589,698 S75T possibly damaging Het
Pbrm1 A G 14: 31,032,530 N190S probably benign Het
Picalm T C 7: 90,170,633 F85L probably damaging Het
Polg A G 7: 79,460,300 V360A possibly damaging Het
Prex1 T C 2: 166,581,921 D1017G probably damaging Het
Prss56 G C 1: 87,188,111 R569P probably damaging Het
Rab6b G A 9: 103,140,384 G25R probably damaging Het
Rdh10 A G 1: 16,131,385 T332A probably benign Het
Rheb A T 5: 24,807,641 M115K probably benign Het
Rnf149 A T 1: 39,555,656 D321E probably benign Het
Slc6a20b A G 9: 123,595,054 V616A probably benign Het
Smarcc2 A G 10: 128,469,300 K300R probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Srp68 C T 11: 116,248,747 V459M probably damaging Het
Stxbp4 C T 11: 90,548,975 V346I probably benign Het
Syne2 A G 12: 75,952,826 D2331G probably damaging Het
Ttn A T 2: 76,734,192 Y28534N probably damaging Het
Usp44 A T 10: 93,846,845 I386F possibly damaging Het
Vmn2r15 T C 5: 109,288,451 probably null Het
Vmn2r72 T A 7: 85,737,853 L834F probably damaging Het
Vps13b T A 15: 35,923,202 I3741K probably damaging Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Zfp607b T A 7: 27,693,636 probably benign Het
Predicted Primers PCR Primer
(F):5'- AGAGTGCATGGTCACTGGAG -3'
(R):5'- TTCCACCCCACTAGTAAGTAGC -3'

Sequencing Primer
(F):5'- TTTATAAAGCCAAGACGCTGCTGG -3'
(R):5'- AGCAGCATTTAACTCTTGTATTGGGC -3'
Posted On2016-06-21