Incidental Mutation 'R5133:Cmya5'
ID395962
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Namecardiomyopathy associated 5
SynonymsMyospryn, 2310076E21Rik, 2310076E16Rik
MMRRC Submission 042721-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R5133 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location93040713-93144724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93093372 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1736 (K1736R)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062122
AA Change: K1736R

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: K1736R

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224009
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik C T 18: 57,563,969 T65I possibly damaging Het
A3galt2 A T 4: 128,762,141 T101S probably damaging Het
Abraxas2 C T 7: 132,883,146 A306V probably benign Het
Acvr1c T A 2: 58,283,506 N248I probably damaging Het
Adgrv1 C T 13: 81,439,441 R4537Q probably damaging Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Afg3l1 T C 8: 123,489,793 V257A probably benign Het
Agbl1 C A 7: 76,422,156 Q334K probably benign Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Apob A T 12: 8,008,898 Q2427L probably damaging Het
Asxl3 T C 18: 22,516,708 C585R probably damaging Het
Baz2a G A 10: 128,116,126 G571D probably damaging Het
Baz2b A T 2: 59,962,024 S587T probably benign Het
Bicdl2 T C 17: 23,661,821 L14P unknown Het
Cachd1 G A 4: 100,994,738 S1177N probably damaging Het
Cacna2d3 A G 14: 29,293,178 F86L possibly damaging Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Col12a1 A G 9: 79,605,174 V2913A probably damaging Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Csn1s1 A G 5: 87,680,878 D267G possibly damaging Het
Cyp2c40 T C 19: 39,807,219 N172S probably benign Het
Dhtkd1 T A 2: 5,904,002 K760N probably damaging Het
Dnah17 T C 11: 118,117,113 K691E probably benign Het
Dppa4 G A 16: 48,292,971 R189Q probably benign Het
Dsp G A 13: 38,197,702 D2808N possibly damaging Het
Egr2 A G 10: 67,539,775 E17G probably damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Epas1 A G 17: 86,809,454 N184S probably damaging Het
Ezh2 C T 6: 47,540,750 C584Y probably damaging Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam186a T G 15: 99,955,493 D122A unknown Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam234b T C 6: 135,209,195 V67A probably benign Het
Fbn2 T C 18: 58,039,340 D2131G probably damaging Het
Fgfr4 T C 13: 55,160,015 Y271H probably damaging Het
Gm960 T A 19: 4,658,421 S194C probably damaging Het
Gnmt A T 17: 46,725,934 S250T probably benign Het
Golgb1 C A 16: 36,891,457 Q208K possibly damaging Het
Grn C A 11: 102,430,554 probably benign Het
Grwd1 T C 7: 45,825,874 T415A probably benign Het
Gsk3b G A 16: 38,240,520 R418H probably damaging Het
Hap1 T G 11: 100,351,531 M382L probably benign Het
Hspa12b A G 2: 131,139,508 E221G possibly damaging Het
Hspa4l T A 3: 40,786,747 D709E possibly damaging Het
Il17ra A G 6: 120,481,553 E555G possibly damaging Het
Il27ra T C 8: 84,034,059 T426A possibly damaging Het
Jup T C 11: 100,383,115 D200G probably benign Het
Kcnq1 T C 7: 143,194,346 probably null Het
Kctd9 C T 14: 67,729,356 T106I probably damaging Het
Kmt5b T A 19: 3,802,240 H159Q probably damaging Het
Kprp C T 3: 92,824,522 R407Q unknown Het
Kras T C 6: 145,232,153 Q131R probably benign Het
Krt16 T A 11: 100,247,631 R230S probably damaging Het
Lpar6 G A 14: 73,238,707 C36Y probably damaging Het
Lrp10 T C 14: 54,469,610 S635P probably benign Het
Mapre2 C A 18: 23,858,133 H153N possibly damaging Het
Mark3 C A 12: 111,655,328 R703S probably damaging Het
Mboat2 A G 12: 24,959,066 D457G probably benign Het
Med13 T C 11: 86,319,849 D489G probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mtus1 T C 8: 41,083,192 T496A probably benign Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Nckap5 T C 1: 126,033,960 H204R probably benign Het
Nlrc4 G T 17: 74,446,717 P224T possibly damaging Het
Olfr1221 A T 2: 89,111,796 probably null Het
Olfr1434 T C 19: 12,283,306 L86P possibly damaging Het
Olfr1480 T A 19: 13,530,078 M135K probably damaging Het
Olfr60 A T 7: 140,345,323 I222N probably damaging Het
Oprl1 T A 2: 181,718,610 I153N probably damaging Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Pcdhb5 T C 18: 37,320,890 F108L probably benign Het
Pde8b T C 13: 95,086,742 I335V probably benign Het
Pdzd7 T A 19: 45,028,429 I886L possibly damaging Het
Prune2 C T 19: 17,003,631 P51S probably damaging Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Samd14 T C 11: 95,021,583 S233P probably damaging Het
Sema6a C A 18: 47,300,128 V79F probably damaging Het
Setbp1 A G 18: 78,857,482 I990T probably damaging Het
Setx A G 2: 29,180,081 R2633G probably benign Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
Slc13a1 A G 6: 24,103,429 S372P possibly damaging Het
Smarcc2 T C 10: 128,461,473 probably null Het
Snrpf T C 10: 93,588,123 S2G probably benign Het
Speer2 C A 16: 69,858,820 K39N probably null Het
Spink5 T G 18: 43,986,423 F267C probably damaging Het
Tgfbrap1 G T 1: 43,075,506 R145S probably damaging Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Tmem64 T C 4: 15,281,119 I304T probably damaging Het
Tomm7 A G 5: 23,844,006 I23T probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttr C T 18: 20,670,110 A111V possibly damaging Het
Usp47 T A 7: 112,083,882 Y561N probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr45b A G 11: 121,328,795 I309T probably benign Het
Wnt6 T C 1: 74,784,596 L364P probably damaging Het
Zc3h13 T C 14: 75,336,009 L1530P probably damaging Het
Zfp933 A G 4: 147,826,864 W60R probably benign Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93093120 missense probably benign 0.13
IGL00516:Cmya5 APN 13 93098167 missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93094161 missense probably benign 0.00
IGL00948:Cmya5 APN 13 93091036 missense probably benign
IGL00966:Cmya5 APN 13 93097906 missense probably benign 0.33
IGL00988:Cmya5 APN 13 93097933 missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93084612 missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93096946 missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93089206 missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93094027 missense probably benign
IGL01679:Cmya5 APN 13 93065320 missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93089299 missense probably benign 0.00
IGL01861:Cmya5 APN 13 93089748 missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93094549 missense probably benign 0.00
IGL02034:Cmya5 APN 13 93084535 splice site probably benign
IGL02103:Cmya5 APN 13 93092127 missense probably benign 0.05
IGL02174:Cmya5 APN 13 93048907 missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93090150 missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93092734 missense probably benign 0.14
IGL02229:Cmya5 APN 13 93092686 missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93098019 missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93090655 missense probably benign 0.40
IGL02409:Cmya5 APN 13 93090198 missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93091858 missense probably benign 0.00
IGL02676:Cmya5 APN 13 93092853 missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93090997 nonsense probably null
IGL02685:Cmya5 APN 13 93090997 nonsense probably null
IGL02686:Cmya5 APN 13 93090997 nonsense probably null
IGL02724:Cmya5 APN 13 93096655 missense probably benign
IGL02727:Cmya5 APN 13 93098245 missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93092557 missense probably benign 0.41
IGL03079:Cmya5 APN 13 93097701 missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93090868 missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93091270 nonsense probably null
IGL03336:Cmya5 APN 13 93093505 missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93065342 missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93089346 missense probably benign 0.22
P4748:Cmya5 UTSW 13 93074475 splice site probably benign
R0123:Cmya5 UTSW 13 93095904 missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0331:Cmya5 UTSW 13 93144403 missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93094869 missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93092748 missense probably benign 0.06
R0416:Cmya5 UTSW 13 93089856 missense probably benign 0.05
R0446:Cmya5 UTSW 13 93093656 missense probably benign
R0457:Cmya5 UTSW 13 93095587 missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93089997 missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93092791 missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93093849 nonsense probably null
R0698:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93094446 missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93095112 missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93041535 missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93041525 missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93092058 missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93065327 missense probably benign 0.44
R1572:Cmya5 UTSW 13 93094269 missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93063519 missense probably benign 0.27
R1735:Cmya5 UTSW 13 93089789 missense probably benign 0.11
R1743:Cmya5 UTSW 13 93097317 missense probably benign 0.33
R1750:Cmya5 UTSW 13 93095663 missense probably benign
R1827:Cmya5 UTSW 13 93074448 missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93090524 missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93092812 missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93069383 missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93093495 missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93093702 missense probably benign 0.15
R2497:Cmya5 UTSW 13 93098005 missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93093558 missense probably benign 0.41
R2917:Cmya5 UTSW 13 93091064 nonsense probably null
R2944:Cmya5 UTSW 13 93092842 nonsense probably null
R3039:Cmya5 UTSW 13 93092250 missense probably benign 0.12
R3078:Cmya5 UTSW 13 93048927 missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93095366 nonsense probably null
R3717:Cmya5 UTSW 13 93092487 missense probably benign 0.12
R3768:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93091219 missense probably benign 0.07
R3888:Cmya5 UTSW 13 93093656 missense probably benign
R3897:Cmya5 UTSW 13 93096681 missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93089199 missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93091956 missense probably benign 0.36
R4471:Cmya5 UTSW 13 93092325 missense probably benign 0.01
R4493:Cmya5 UTSW 13 93094065 missense probably benign
R4495:Cmya5 UTSW 13 93094065 missense probably benign
R4544:Cmya5 UTSW 13 93091918 nonsense probably null
R4545:Cmya5 UTSW 13 93091918 nonsense probably null
R4624:Cmya5 UTSW 13 93063551 missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93093574 missense probably benign 0.04
R4965:Cmya5 UTSW 13 93095787 missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93090585 missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93091603 missense possibly damaging 0.61
R5139:Cmya5 UTSW 13 93096061 missense probably benign 0.00
R5220:Cmya5 UTSW 13 93092296 missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93096195 missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93083273 missense probably benign 0.28
R5356:Cmya5 UTSW 13 93063485 missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93091968 missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93095199 missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93092763 missense probably benign 0.15
R5628:Cmya5 UTSW 13 93089710 missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93045949 missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93098176 missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93045866 critical splice donor site probably null
R5806:Cmya5 UTSW 13 93093937 missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93092780 missense probably benign 0.04
R5872:Cmya5 UTSW 13 93097435 missense probably benign 0.01
R5875:Cmya5 UTSW 13 93095184 missense probably benign 0.13
R5896:Cmya5 UTSW 13 93045865 critical splice donor site probably null
R5910:Cmya5 UTSW 13 93092643 missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93089544 missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93089649 missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93144513 unclassified probably benign
R6102:Cmya5 UTSW 13 93094231 missense probably benign
R6117:Cmya5 UTSW 13 93095166 missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93093444 missense possibly damaging 0.61
R6188:Cmya5 UTSW 13 93097276 missense possibly damaging 0.73
R6219:Cmya5 UTSW 13 93094443 missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93093306 missense probably benign 0.41
R6346:Cmya5 UTSW 13 93092190 missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93074464 missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93089215 missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93089808 missense probably benign 0.05
R6649:Cmya5 UTSW 13 93098025 missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93092895 missense probably benign 0.04
R6652:Cmya5 UTSW 13 93093039 missense probably damaging 0.99
R6669:Cmya5 UTSW 13 93093259 missense probably benign 0.03
R6881:Cmya5 UTSW 13 93090292 missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93091252 missense probably benign 0.04
R6933:Cmya5 UTSW 13 93095136 missense probably benign 0.03
R7021:Cmya5 UTSW 13 93093555 missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93069278 critical splice donor site probably null
R7068:Cmya5 UTSW 13 93092697 missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93090975 missense not run
R7088:Cmya5 UTSW 13 93091864 missense not run
R7126:Cmya5 UTSW 13 93089940 missense not run
X0028:Cmya5 UTSW 13 93096687 missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93063579 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGATCAGTGCTCTCAGAGG -3'
(R):5'- TCTATCTTAGAAAAGGGCCCCG -3'

Sequencing Primer
(F):5'- TCTCAGAGGACTCCAGCTG -3'
(R):5'- TTAGAAAAGGGCCCCGCTGAG -3'
Posted On2016-06-21