Incidental Mutation 'R0450:Etfbkmt'
ID39597
Institutional Source Beutler Lab
Gene Symbol Etfbkmt
Ensembl Gene ENSMUSG00000039958
Gene Nameelectron transfer flavoprotein beta subunit lysine methyltransferase
Synonyms4833442J19Rik, Mettl20
MMRRC Submission 038650-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R0450 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location149139849-149151171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 149150584 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 96 (R96W)
Ref Sequence ENSEMBL: ENSMUSP00000144830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047531] [ENSMUST00000111551] [ENSMUST00000134306] [ENSMUST00000147934] [ENSMUST00000166416] [ENSMUST00000179873]
Predicted Effect probably benign
Transcript: ENSMUST00000047531
AA Change: R223W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042102
Gene: ENSMUSG00000039958
AA Change: R223W

DomainStartEndE-ValueType
Pfam:Methyltransf_16 86 216 2.1e-10 PFAM
Pfam:MTS 91 189 1e-7 PFAM
Pfam:PrmA 94 180 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111551
AA Change: R223W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107176
Gene: ENSMUSG00000039958
AA Change: R223W

DomainStartEndE-ValueType
Pfam:Methyltransf_16 86 218 1.9e-10 PFAM
Pfam:MTS 91 187 1.1e-7 PFAM
Pfam:PrmA 94 180 1.5e-12 PFAM
Pfam:Methyltransf_26 109 214 4.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134306
SMART Domains Protein: ENSMUSP00000118701
Gene: ENSMUSG00000039958

DomainStartEndE-ValueType
Pfam:Methyltransf_16 85 158 1.3e-7 PFAM
Pfam:PrmA 94 159 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147934
AA Change: R96W

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000144830
Gene: ENSMUSG00000039958
AA Change: R96W

DomainStartEndE-ValueType
SCOP:d1f3la_ 2 100 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166416
SMART Domains Protein: ENSMUSP00000126521
Gene: ENSMUSG00000039958

DomainStartEndE-ValueType
Pfam:Methyltransf_16 85 159 1.3e-7 PFAM
Pfam:PrmA 94 164 1.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179873
AA Change: R223W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136167
Gene: ENSMUSG00000039958
AA Change: R223W

DomainStartEndE-ValueType
Pfam:Methyltransf_16 86 218 1.9e-10 PFAM
Pfam:MTS 91 187 1.1e-7 PFAM
Pfam:PrmA 94 180 1.5e-12 PFAM
Pfam:Methyltransf_26 109 214 4.6e-8 PFAM
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl G A 2: 127,880,503 probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Arih2 T A 9: 108,605,092 H490L possibly damaging Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Cep76 A T 18: 67,634,780 N227K probably benign Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Glipr1l2 A G 10: 112,092,572 D124G probably benign Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hnrnph3 T A 10: 63,018,215 R41S probably benign Het
Hnrnph3 T A 10: 63,019,500 D2V probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mospd3 A G 5: 137,597,032 L233P probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Stk11 T C 10: 80,126,086 V47A probably damaging Het
Tmpo A C 10: 91,163,096 I276M probably benign Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Upb1 T C 10: 75,415,083 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Etfbkmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02455:Etfbkmt APN 6 149147226 missense probably damaging 1.00
IGL03149:Etfbkmt APN 6 149144283 missense probably damaging 1.00
R0510:Etfbkmt UTSW 6 149150584 missense probably benign 0.02
R1862:Etfbkmt UTSW 6 149144151 start codon destroyed probably null 0.95
R4111:Etfbkmt UTSW 6 149144591 intron probably benign
R4112:Etfbkmt UTSW 6 149144591 intron probably benign
R4786:Etfbkmt UTSW 6 149147246 start codon destroyed probably benign 0.01
R5053:Etfbkmt UTSW 6 149147268 nonsense probably null
R5304:Etfbkmt UTSW 6 149147206 missense probably damaging 1.00
R5780:Etfbkmt UTSW 6 149147159 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAAGTTGCAGGAATGGCGATTACAC -3'
(R):5'- TGACACCTTGGTATGTGAAATGGGAAC -3'

Sequencing Primer
(F):5'- AAATGGACTGAATCCTTTTCCTG -3'
(R):5'- cgcctacttcagcctcc -3'
Posted On2013-05-23