Incidental Mutation 'R5133:Fbn2'
ID395987
Institutional Source Beutler Lab
Gene Symbol Fbn2
Ensembl Gene ENSMUSG00000024598
Gene Namefibrillin 2
SynonymsFib-2, sy, Sne
MMRRC Submission 042721-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R5133 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location58008623-58209926 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58039340 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2131 (D2131G)
Ref Sequence ENSEMBL: ENSMUSP00000025497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025497]
Predicted Effect probably damaging
Transcript: ENSMUST00000025497
AA Change: D2131G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: D2131G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
low complexity region 68 77 N/A INTRINSIC
EGF 148 176 1.15e1 SMART
EGF 179 208 1.26e-2 SMART
Pfam:TB 224 262 3.7e-10 PFAM
EGF_CA 276 317 8.3e-12 SMART
EGF_CA 318 359 9.25e-10 SMART
Pfam:TB 374 416 4.3e-13 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
EGF 490 527 1.13e-4 SMART
EGF_CA 528 567 2.26e-13 SMART
EGF_CA 568 609 9.03e-13 SMART
EGF_CA 610 650 6.2e-11 SMART
EGF_CA 651 691 7.75e-12 SMART
Pfam:TB 707 748 5.2e-15 PFAM
EGF_CA 761 802 6.29e-12 SMART
EGF_CA 803 844 1.97e-13 SMART
EGF_CA 845 884 1.61e-9 SMART
Pfam:TB 899 935 1.8e-9 PFAM
EGF_CA 948 989 4.7e-11 SMART
Pfam:TB 1004 1044 1.3e-16 PFAM
EGF_CA 1066 1107 3.05e-10 SMART
EGF_CA 1108 1150 2.19e-11 SMART
EGF_CA 1151 1192 2.04e-11 SMART
EGF_CA 1193 1234 3.15e-12 SMART
EGF_CA 1235 1275 1.82e-8 SMART
EGF_CA 1276 1317 9.91e-10 SMART
EGF_CA 1318 1359 1.48e-8 SMART
EGF_CA 1360 1400 6.54e-10 SMART
EGF_CA 1401 1441 4.63e-10 SMART
EGF_CA 1442 1483 7.75e-12 SMART
EGF_CA 1484 1524 5.23e-9 SMART
EGF_CA 1525 1565 2.13e-9 SMART
Pfam:TB 1585 1625 3.4e-15 PFAM
EGF_CA 1643 1684 6.74e-12 SMART
EGF_CA 1685 1726 1.06e-9 SMART
Pfam:TB 1741 1783 1.2e-17 PFAM
EGF_CA 1801 1842 7.34e-13 SMART
EGF_CA 1843 1884 4.15e-12 SMART
EGF_CA 1885 1926 5.23e-9 SMART
EGF_CA 1927 1965 5.87e-12 SMART
EGF_CA 1966 2008 1.11e-12 SMART
EGF_CA 2009 2048 1.26e-11 SMART
EGF_CA 2049 2090 7.12e-11 SMART
Pfam:TB 2105 2147 1.2e-15 PFAM
EGF_CA 2164 2205 2.89e-11 SMART
EGF_CA 2206 2245 1.1e-11 SMART
EGF_CA 2246 2286 3.76e-10 SMART
EGF_CA 2287 2330 1.44e-6 SMART
EGF_CA 2331 2372 1.16e-10 SMART
Pfam:TB 2387 2429 1.9e-16 PFAM
EGF_CA 2442 2483 8.43e-13 SMART
EGF_CA 2484 2524 4.96e-10 SMART
EGF_CA 2525 2563 7.63e-11 SMART
EGF_CA 2564 2606 6.44e-9 SMART
EGF_CA 2607 2646 2.28e-9 SMART
EGF_CA 2647 2687 1.79e-7 SMART
EGF_CA 2688 2727 3.45e-9 SMART
low complexity region 2774 2786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik C T 18: 57,563,969 T65I possibly damaging Het
A3galt2 A T 4: 128,762,141 T101S probably damaging Het
Abraxas2 C T 7: 132,883,146 A306V probably benign Het
Acvr1c T A 2: 58,283,506 N248I probably damaging Het
Adgrv1 C T 13: 81,439,441 R4537Q probably damaging Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Afg3l1 T C 8: 123,489,793 V257A probably benign Het
Agbl1 C A 7: 76,422,156 Q334K probably benign Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Apob A T 12: 8,008,898 Q2427L probably damaging Het
Asxl3 T C 18: 22,516,708 C585R probably damaging Het
Baz2a G A 10: 128,116,126 G571D probably damaging Het
Baz2b A T 2: 59,962,024 S587T probably benign Het
Bicdl2 T C 17: 23,661,821 L14P unknown Het
Cachd1 G A 4: 100,994,738 S1177N probably damaging Het
Cacna2d3 A G 14: 29,293,178 F86L possibly damaging Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cmya5 T C 13: 93,093,372 K1736R possibly damaging Het
Col12a1 A G 9: 79,605,174 V2913A probably damaging Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Csn1s1 A G 5: 87,680,878 D267G possibly damaging Het
Cyp2c40 T C 19: 39,807,219 N172S probably benign Het
Dhtkd1 T A 2: 5,904,002 K760N probably damaging Het
Dnah17 T C 11: 118,117,113 K691E probably benign Het
Dppa4 G A 16: 48,292,971 R189Q probably benign Het
Dsp G A 13: 38,197,702 D2808N possibly damaging Het
Egr2 A G 10: 67,539,775 E17G probably damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Epas1 A G 17: 86,809,454 N184S probably damaging Het
Ezh2 C T 6: 47,540,750 C584Y probably damaging Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam186a T G 15: 99,955,493 D122A unknown Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam234b T C 6: 135,209,195 V67A probably benign Het
Fgfr4 T C 13: 55,160,015 Y271H probably damaging Het
Gm960 T A 19: 4,658,421 S194C probably damaging Het
Gnmt A T 17: 46,725,934 S250T probably benign Het
Golgb1 C A 16: 36,891,457 Q208K possibly damaging Het
Grn C A 11: 102,430,554 probably benign Het
Grwd1 T C 7: 45,825,874 T415A probably benign Het
Gsk3b G A 16: 38,240,520 R418H probably damaging Het
Hap1 T G 11: 100,351,531 M382L probably benign Het
Hspa12b A G 2: 131,139,508 E221G possibly damaging Het
Hspa4l T A 3: 40,786,747 D709E possibly damaging Het
Il17ra A G 6: 120,481,553 E555G possibly damaging Het
Il27ra T C 8: 84,034,059 T426A possibly damaging Het
Jup T C 11: 100,383,115 D200G probably benign Het
Kcnq1 T C 7: 143,194,346 probably null Het
Kctd9 C T 14: 67,729,356 T106I probably damaging Het
Kmt5b T A 19: 3,802,240 H159Q probably damaging Het
Kprp C T 3: 92,824,522 R407Q unknown Het
Kras T C 6: 145,232,153 Q131R probably benign Het
Krt16 T A 11: 100,247,631 R230S probably damaging Het
Lpar6 G A 14: 73,238,707 C36Y probably damaging Het
Lrp10 T C 14: 54,469,610 S635P probably benign Het
Mapre2 C A 18: 23,858,133 H153N possibly damaging Het
Mark3 C A 12: 111,655,328 R703S probably damaging Het
Mboat2 A G 12: 24,959,066 D457G probably benign Het
Med13 T C 11: 86,319,849 D489G probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mtus1 T C 8: 41,083,192 T496A probably benign Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Nckap5 T C 1: 126,033,960 H204R probably benign Het
Nlrc4 G T 17: 74,446,717 P224T possibly damaging Het
Olfr1221 A T 2: 89,111,796 probably null Het
Olfr1434 T C 19: 12,283,306 L86P possibly damaging Het
Olfr1480 T A 19: 13,530,078 M135K probably damaging Het
Olfr60 A T 7: 140,345,323 I222N probably damaging Het
Oprl1 T A 2: 181,718,610 I153N probably damaging Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Pcdhb5 T C 18: 37,320,890 F108L probably benign Het
Pde8b T C 13: 95,086,742 I335V probably benign Het
Pdzd7 T A 19: 45,028,429 I886L possibly damaging Het
Prune2 C T 19: 17,003,631 P51S probably damaging Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Samd14 T C 11: 95,021,583 S233P probably damaging Het
Sema6a C A 18: 47,300,128 V79F probably damaging Het
Setbp1 A G 18: 78,857,482 I990T probably damaging Het
Setx A G 2: 29,180,081 R2633G probably benign Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
Slc13a1 A G 6: 24,103,429 S372P possibly damaging Het
Smarcc2 T C 10: 128,461,473 probably null Het
Snrpf T C 10: 93,588,123 S2G probably benign Het
Speer2 C A 16: 69,858,820 K39N probably null Het
Spink5 T G 18: 43,986,423 F267C probably damaging Het
Tgfbrap1 G T 1: 43,075,506 R145S probably damaging Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Tmem64 T C 4: 15,281,119 I304T probably damaging Het
Tomm7 A G 5: 23,844,006 I23T probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttr C T 18: 20,670,110 A111V possibly damaging Het
Usp47 T A 7: 112,083,882 Y561N probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr45b A G 11: 121,328,795 I309T probably benign Het
Wnt6 T C 1: 74,784,596 L364P probably damaging Het
Zc3h13 T C 14: 75,336,009 L1530P probably damaging Het
Zfp933 A G 4: 147,826,864 W60R probably benign Het
Other mutations in Fbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Fbn2 APN 18 58037809 missense possibly damaging 0.81
IGL00780:Fbn2 APN 18 58095988 missense probably damaging 1.00
IGL00923:Fbn2 APN 18 58012325 missense probably benign 0.00
IGL01011:Fbn2 APN 18 58095240 splice site probably benign
IGL01123:Fbn2 APN 18 58104081 missense possibly damaging 0.62
IGL01304:Fbn2 APN 18 58061745 missense probably damaging 0.97
IGL01339:Fbn2 APN 18 58113370 missense possibly damaging 0.75
IGL01465:Fbn2 APN 18 58203833 missense probably null 0.67
IGL01608:Fbn2 APN 18 58053704 nonsense probably null
IGL01682:Fbn2 APN 18 58072671 missense probably damaging 1.00
IGL01752:Fbn2 APN 18 58075977 splice site probably null
IGL01764:Fbn2 APN 18 58045351 missense probably damaging 1.00
IGL02002:Fbn2 APN 18 58114553 missense probably benign 0.01
IGL02010:Fbn2 APN 18 58037722 missense probably damaging 0.99
IGL02029:Fbn2 APN 18 58209603 missense probably benign 0.04
IGL02037:Fbn2 APN 18 58096015 missense probably damaging 1.00
IGL02350:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02357:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02653:Fbn2 APN 18 58076705 missense probably benign
IGL03233:Fbn2 APN 18 58102377 missense probably benign 0.39
IGL03347:Fbn2 APN 18 58013665 missense probably damaging 1.00
IGL03410:Fbn2 APN 18 58050243 missense possibly damaging 0.95
pinch UTSW 18 58069184 missense probably damaging 1.00
stick UTSW 18 58071819 missense possibly damaging 0.94
tweak UTSW 18 58058389 missense probably damaging 1.00
PIT4434001:Fbn2 UTSW 18 58096062 missense probably damaging 0.99
R0020:Fbn2 UTSW 18 58105164 missense probably damaging 1.00
R0069:Fbn2 UTSW 18 58069184 missense probably damaging 1.00
R0107:Fbn2 UTSW 18 58056203 missense probably benign 0.00
R0116:Fbn2 UTSW 18 58102373 nonsense probably null
R0277:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0284:Fbn2 UTSW 18 58050290 splice site probably benign
R0316:Fbn2 UTSW 18 58113325 missense probably damaging 1.00
R0323:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0421:Fbn2 UTSW 18 58027804 splice site probably benign
R0455:Fbn2 UTSW 18 58035336 missense probably damaging 1.00
R0504:Fbn2 UTSW 18 58039460 missense possibly damaging 0.94
R0520:Fbn2 UTSW 18 58013749 missense probably damaging 1.00
R0632:Fbn2 UTSW 18 58037747 missense probably damaging 1.00
R0638:Fbn2 UTSW 18 58045374 missense probably damaging 0.98
R0645:Fbn2 UTSW 18 58058389 missense probably damaging 1.00
R1051:Fbn2 UTSW 18 58012353 missense probably damaging 0.99
R1209:Fbn2 UTSW 18 58070016 missense probably benign 0.00
R1319:Fbn2 UTSW 18 58200610 missense possibly damaging 0.88
R1400:Fbn2 UTSW 18 58080193 missense possibly damaging 0.90
R1437:Fbn2 UTSW 18 58053659 missense possibly damaging 0.68
R1463:Fbn2 UTSW 18 58010380 missense probably benign
R1612:Fbn2 UTSW 18 58061752 missense probably damaging 1.00
R1623:Fbn2 UTSW 18 58048548 missense possibly damaging 0.61
R1629:Fbn2 UTSW 18 58026538 missense probably damaging 1.00
R1639:Fbn2 UTSW 18 58058462 missense probably benign 0.41
R1722:Fbn2 UTSW 18 58048052 critical splice acceptor site probably null
R1749:Fbn2 UTSW 18 58050276 missense probably benign 0.35
R1802:Fbn2 UTSW 18 58052976 nonsense probably null
R1850:Fbn2 UTSW 18 58039305 splice site probably benign
R1913:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R2045:Fbn2 UTSW 18 58090658 missense probably damaging 1.00
R2064:Fbn2 UTSW 18 58048849 missense probably damaging 0.99
R2143:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2144:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2149:Fbn2 UTSW 18 58102325 splice site probably null
R2207:Fbn2 UTSW 18 58081399 nonsense probably null
R2219:Fbn2 UTSW 18 58052963 missense possibly damaging 0.79
R2263:Fbn2 UTSW 18 58095176 splice site probably benign
R2375:Fbn2 UTSW 18 58035966 missense probably damaging 1.00
R2424:Fbn2 UTSW 18 58203787 missense probably damaging 0.99
R2504:Fbn2 UTSW 18 58093359 missense probably damaging 0.99
R2879:Fbn2 UTSW 18 58069242 missense probably damaging 0.97
R3040:Fbn2 UTSW 18 58093387 missense probably damaging 1.00
R3080:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R3625:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R3901:Fbn2 UTSW 18 58066011 missense probably damaging 0.97
R4089:Fbn2 UTSW 18 58053769 missense probably benign 0.01
R4133:Fbn2 UTSW 18 58095962 missense possibly damaging 0.82
R4155:Fbn2 UTSW 18 58023287 nonsense probably null
R4288:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4289:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4363:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R4559:Fbn2 UTSW 18 58076074 missense probably benign 0.00
R4601:Fbn2 UTSW 18 58053733 missense probably damaging 1.00
R4609:Fbn2 UTSW 18 58190269 nonsense probably null
R4626:Fbn2 UTSW 18 58013747 nonsense probably null
R4638:Fbn2 UTSW 18 58010304 missense probably benign 0.01
R4675:Fbn2 UTSW 18 58040193 missense possibly damaging 0.95
R4707:Fbn2 UTSW 18 58056272 missense probably damaging 1.00
R4758:Fbn2 UTSW 18 58026386 missense probably benign 0.00
R4945:Fbn2 UTSW 18 58050253 missense possibly damaging 0.53
R4955:Fbn2 UTSW 18 58058383 missense possibly damaging 0.61
R4980:Fbn2 UTSW 18 58010631 missense probably benign 0.05
R4998:Fbn2 UTSW 18 58072631 missense probably damaging 1.00
R5322:Fbn2 UTSW 18 58039315 missense probably benign 0.00
R5414:Fbn2 UTSW 18 58093405 missense probably damaging 0.96
R5538:Fbn2 UTSW 18 58071901 missense probably benign 0.22
R5557:Fbn2 UTSW 18 58115659 missense probably benign 0.00
R5754:Fbn2 UTSW 18 58124311 missense probably benign 0.04
R5769:Fbn2 UTSW 18 58105199 missense probably damaging 1.00
R5790:Fbn2 UTSW 18 58076696 missense probably benign 0.34
R5830:Fbn2 UTSW 18 58114469 missense probably benign 0.01
R5845:Fbn2 UTSW 18 58053768 missense possibly damaging 0.89
R5880:Fbn2 UTSW 18 58023282 nonsense probably null
R5907:Fbn2 UTSW 18 58045337 missense probably damaging 1.00
R5948:Fbn2 UTSW 18 58037049 missense probably damaging 1.00
R5955:Fbn2 UTSW 18 58044256 missense probably damaging 1.00
R5974:Fbn2 UTSW 18 58048920 missense probably damaging 1.00
R6010:Fbn2 UTSW 18 58069524 missense probably benign 0.31
R6024:Fbn2 UTSW 18 58076836 missense probably benign 0.03
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6315:Fbn2 UTSW 18 58054953 critical splice acceptor site probably null
R6437:Fbn2 UTSW 18 58113363 missense probably damaging 1.00
R6519:Fbn2 UTSW 18 58063575 missense possibly damaging 0.61
R6520:Fbn2 UTSW 18 58102390 missense probably damaging 1.00
R6734:Fbn2 UTSW 18 58035960 missense probably damaging 1.00
R6755:Fbn2 UTSW 18 58113333 missense possibly damaging 0.89
R6789:Fbn2 UTSW 18 58010614 missense probably benign 0.00
R6801:Fbn2 UTSW 18 58113348 missense probably benign 0.04
R6862:Fbn2 UTSW 18 58124321 missense probably benign 0.04
R6900:Fbn2 UTSW 18 58076831 missense probably benign
R6906:Fbn2 UTSW 18 58071819 missense possibly damaging 0.94
R6919:Fbn2 UTSW 18 58124187 intron probably null
R6950:Fbn2 UTSW 18 58035921 missense probably null 0.21
R6985:Fbn2 UTSW 18 58068388 missense probably damaging 1.00
R7056:Fbn2 UTSW 18 58076726 missense probably benign
X0062:Fbn2 UTSW 18 58056213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCTGTGCATGAATGTTG -3'
(R):5'- CCACGTGTTTAAAGAGCGGTG -3'

Sequencing Primer
(F):5'- GTTCTATACAAAGCTATAACTTCCCC -3'
(R):5'- AGCGGTGAGGAGCTCTG -3'
Posted On2016-06-21