Incidental Mutation 'R5133:Setbp1'
ID395989
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene NameSET binding protein 1
SynonymsSeb
MMRRC Submission 042721-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.433) question?
Stock #R5133 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location78750380-79109391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78857482 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 990 (I990T)
Ref Sequence ENSEMBL: ENSMUSP00000025430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
Predicted Effect probably damaging
Transcript: ENSMUST00000025430
AA Change: I990T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: I990T

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161465
AA Change: I990T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124497
Gene: ENSMUSG00000024548
AA Change: I990T

DomainStartEndE-ValueType
low complexity region 46 55 N/A INTRINSIC
low complexity region 202 212 N/A INTRINSIC
low complexity region 268 298 N/A INTRINSIC
low complexity region 325 333 N/A INTRINSIC
AT_hook 575 587 4.64e-1 SMART
low complexity region 612 618 N/A INTRINSIC
low complexity region 641 664 N/A INTRINSIC
low complexity region 925 934 N/A INTRINSIC
AT_hook 1007 1019 1.89e-1 SMART
low complexity region 1133 1150 N/A INTRINSIC
low complexity region 1363 1384 N/A INTRINSIC
AT_hook 1440 1452 7.27e-1 SMART
low complexity region 1509 1533 N/A INTRINSIC
low complexity region 1545 1561 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik C T 18: 57,563,969 T65I possibly damaging Het
A3galt2 A T 4: 128,762,141 T101S probably damaging Het
Abraxas2 C T 7: 132,883,146 A306V probably benign Het
Acvr1c T A 2: 58,283,506 N248I probably damaging Het
Adgrv1 C T 13: 81,439,441 R4537Q probably damaging Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Afg3l1 T C 8: 123,489,793 V257A probably benign Het
Agbl1 C A 7: 76,422,156 Q334K probably benign Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Apob A T 12: 8,008,898 Q2427L probably damaging Het
Asxl3 T C 18: 22,516,708 C585R probably damaging Het
Baz2a G A 10: 128,116,126 G571D probably damaging Het
Baz2b A T 2: 59,962,024 S587T probably benign Het
Bicdl2 T C 17: 23,661,821 L14P unknown Het
Cachd1 G A 4: 100,994,738 S1177N probably damaging Het
Cacna2d3 A G 14: 29,293,178 F86L possibly damaging Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cmya5 T C 13: 93,093,372 K1736R possibly damaging Het
Col12a1 A G 9: 79,605,174 V2913A probably damaging Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Csn1s1 A G 5: 87,680,878 D267G possibly damaging Het
Cyp2c40 T C 19: 39,807,219 N172S probably benign Het
Dhtkd1 T A 2: 5,904,002 K760N probably damaging Het
Dnah17 T C 11: 118,117,113 K691E probably benign Het
Dppa4 G A 16: 48,292,971 R189Q probably benign Het
Dsp G A 13: 38,197,702 D2808N possibly damaging Het
Egr2 A G 10: 67,539,775 E17G probably damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Epas1 A G 17: 86,809,454 N184S probably damaging Het
Ezh2 C T 6: 47,540,750 C584Y probably damaging Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam186a T G 15: 99,955,493 D122A unknown Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam234b T C 6: 135,209,195 V67A probably benign Het
Fbn2 T C 18: 58,039,340 D2131G probably damaging Het
Fgfr4 T C 13: 55,160,015 Y271H probably damaging Het
Gm960 T A 19: 4,658,421 S194C probably damaging Het
Gnmt A T 17: 46,725,934 S250T probably benign Het
Golgb1 C A 16: 36,891,457 Q208K possibly damaging Het
Grn C A 11: 102,430,554 probably benign Het
Grwd1 T C 7: 45,825,874 T415A probably benign Het
Gsk3b G A 16: 38,240,520 R418H probably damaging Het
Hap1 T G 11: 100,351,531 M382L probably benign Het
Hspa12b A G 2: 131,139,508 E221G possibly damaging Het
Hspa4l T A 3: 40,786,747 D709E possibly damaging Het
Il17ra A G 6: 120,481,553 E555G possibly damaging Het
Il27ra T C 8: 84,034,059 T426A possibly damaging Het
Jup T C 11: 100,383,115 D200G probably benign Het
Kcnq1 T C 7: 143,194,346 probably null Het
Kctd9 C T 14: 67,729,356 T106I probably damaging Het
Kmt5b T A 19: 3,802,240 H159Q probably damaging Het
Kprp C T 3: 92,824,522 R407Q unknown Het
Kras T C 6: 145,232,153 Q131R probably benign Het
Krt16 T A 11: 100,247,631 R230S probably damaging Het
Lpar6 G A 14: 73,238,707 C36Y probably damaging Het
Lrp10 T C 14: 54,469,610 S635P probably benign Het
Mapre2 C A 18: 23,858,133 H153N possibly damaging Het
Mark3 C A 12: 111,655,328 R703S probably damaging Het
Mboat2 A G 12: 24,959,066 D457G probably benign Het
Med13 T C 11: 86,319,849 D489G probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mtus1 T C 8: 41,083,192 T496A probably benign Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Nckap5 T C 1: 126,033,960 H204R probably benign Het
Nlrc4 G T 17: 74,446,717 P224T possibly damaging Het
Olfr1221 A T 2: 89,111,796 probably null Het
Olfr1434 T C 19: 12,283,306 L86P possibly damaging Het
Olfr1480 T A 19: 13,530,078 M135K probably damaging Het
Olfr60 A T 7: 140,345,323 I222N probably damaging Het
Oprl1 T A 2: 181,718,610 I153N probably damaging Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Pcdhb5 T C 18: 37,320,890 F108L probably benign Het
Pde8b T C 13: 95,086,742 I335V probably benign Het
Pdzd7 T A 19: 45,028,429 I886L possibly damaging Het
Prune2 C T 19: 17,003,631 P51S probably damaging Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Samd14 T C 11: 95,021,583 S233P probably damaging Het
Sema6a C A 18: 47,300,128 V79F probably damaging Het
Setx A G 2: 29,180,081 R2633G probably benign Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
Slc13a1 A G 6: 24,103,429 S372P possibly damaging Het
Smarcc2 T C 10: 128,461,473 probably null Het
Snrpf T C 10: 93,588,123 S2G probably benign Het
Speer2 C A 16: 69,858,820 K39N probably null Het
Spink5 T G 18: 43,986,423 F267C probably damaging Het
Tgfbrap1 G T 1: 43,075,506 R145S probably damaging Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Tmem64 T C 4: 15,281,119 I304T probably damaging Het
Tomm7 A G 5: 23,844,006 I23T probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttr C T 18: 20,670,110 A111V possibly damaging Het
Usp47 T A 7: 112,083,882 Y561N probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr45b A G 11: 121,328,795 I309T probably benign Het
Wnt6 T C 1: 74,784,596 L364P probably damaging Het
Zc3h13 T C 14: 75,336,009 L1530P probably damaging Het
Zfp933 A G 4: 147,826,864 W60R probably benign Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78755679 nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78857770 missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78856777 missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78857410 missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78857299 missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78857473 missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78755710 missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78857374 nonsense probably null
IGL03005:Setbp1 APN 18 78859125 missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78857009 missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78857626 missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78857860 missense probably damaging 1.00
R1167:Setbp1 UTSW 18 78857236 missense possibly damaging 0.85
R1221:Setbp1 UTSW 18 78856583 missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78858208 missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78783358 missense probably benign 0.00
R1481:Setbp1 UTSW 18 78783301 missense probably benign 0.01
R1482:Setbp1 UTSW 18 79086835 missense probably damaging 1.00
R1496:Setbp1 UTSW 18 78859912 missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78858592 missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78858467 missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78857398 missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78858362 missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78858544 missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78856720 missense probably benign 0.00
R2851:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2853:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2941:Setbp1 UTSW 18 78858197 missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78857435 missense probably damaging 1.00
R3156:Setbp1 UTSW 18 78859303 missense probably benign 0.00
R3807:Setbp1 UTSW 18 78783322 missense probably benign 0.01
R4133:Setbp1 UTSW 18 78856991 missense probably benign 0.05
R4287:Setbp1 UTSW 18 78859061 missense probably benign 0.03
R4345:Setbp1 UTSW 18 79086579 missense probably damaging 0.99
R4374:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4377:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78856618 missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79086681 missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79086949 missense probably benign 0.00
R4595:Setbp1 UTSW 18 78857516 missense probably benign 0.00
R4817:Setbp1 UTSW 18 78858800 missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78858167 missense probably benign 0.07
R4976:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78856594 missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78857299 missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78857999 missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78856975 missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78858063 missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79086652 missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78857485 missense probably damaging 1.00
R5722:Setbp1 UTSW 18 78856645 missense possibly damaging 0.95
R5806:Setbp1 UTSW 18 78856482 unclassified probably null
R5940:Setbp1 UTSW 18 78755488 missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78859240 missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6250:Setbp1 UTSW 18 78858002 missense probably benign 0.00
R6256:Setbp1 UTSW 18 78857257 missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78783369 missense probably benign 0.21
R6522:Setbp1 UTSW 18 78857390 missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78859559 missense probably benign 0.00
R6886:Setbp1 UTSW 18 78857500 missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78857839 missense probably damaging 1.00
R7042:Setbp1 UTSW 18 79086855 missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79086960 missense probably benign 0.08
R7134:Setbp1 UTSW 18 78859519 missense possibly damaging 0.86
R7215:Setbp1 UTSW 18 78856837 missense probably damaging 0.97
R7219:Setbp1 UTSW 18 78755745 missense probably damaging 1.00
R7378:Setbp1 UTSW 18 78857486 missense probably damaging 1.00
Z1088:Setbp1 UTSW 18 78859594 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAAGGCATTCCATAGGGTGC -3'
(R):5'- TCATTGTGGACACTTTTCTGGC -3'

Sequencing Primer
(F):5'- AGGGTGCATAGTAACTTCCACTG -3'
(R):5'- ACTTTTCTGGCCCACGAAAG -3'
Posted On2016-06-21