Incidental Mutation 'R5134:Pde8b'
ID396069
Institutional Source Beutler Lab
Gene Symbol Pde8b
Ensembl Gene ENSMUSG00000021684
Gene Namephosphodiesterase 8B
SynonymsB230331L10Rik, C030047E14Rik
MMRRC Submission 042722-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R5134 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location95024454-95250336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95086742 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 335 (I335V)
Ref Sequence ENSEMBL: ENSMUSP00000128987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022192] [ENSMUST00000067082] [ENSMUST00000159608] [ENSMUST00000160957] [ENSMUST00000162153] [ENSMUST00000162292] [ENSMUST00000162412] [ENSMUST00000172104]
Predicted Effect probably benign
Transcript: ENSMUST00000022192
SMART Domains Protein: ENSMUSP00000022192
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.9e-15 PFAM
Blast:HDc 420 481 1e-20 BLAST
HDc 565 748 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067082
AA Change: I315V

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000070465
Gene: ENSMUSG00000021684
AA Change: I315V

DomainStartEndE-ValueType
Pfam:PDE8 1 47 1.4e-32 PFAM
low complexity region 75 98 N/A INTRINSIC
Blast:REC 112 235 6e-45 BLAST
PAS 249 316 3.59e-3 SMART
Blast:HDc 447 508 1e-20 BLAST
HDc 592 775 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159608
SMART Domains Protein: ENSMUSP00000125191
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
Pfam:PDE8 1 52 1.7e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.1e-15 PFAM
Blast:HDc 420 481 1e-20 BLAST
HDc 565 666 9.37e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160957
SMART Domains Protein: ENSMUSP00000125115
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Response_reg 30 148 5.7e-16 PFAM
Blast:PAS 165 188 1e-7 BLAST
Blast:HDc 266 327 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162153
AA Change: I230V

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124704
Gene: ENSMUSG00000021684
AA Change: I230V

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.6e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 362 423 1e-20 BLAST
HDc 507 690 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162292
SMART Domains Protein: ENSMUSP00000124068
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.1e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.6e-15 PFAM
Blast:HDc 370 431 1e-20 BLAST
HDc 515 698 3.01e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162328
Predicted Effect probably benign
Transcript: ENSMUST00000162412
AA Change: I230V

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124409
Gene: ENSMUSG00000021684
AA Change: I230V

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.3e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 312 373 1e-20 BLAST
HDc 457 640 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172104
AA Change: I335V

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128987
Gene: ENSMUSG00000021684
AA Change: I335V

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.8e-15 PFAM
PAS 269 336 3.59e-3 SMART
HDc 557 740 3.01e-3 SMART
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cyclic nucleotide phosphodiesterase (PDE) that catalyzes the hydrolysis of the second messenger cAMP. The encoded protein, which does not hydrolyze cGMP, is resistant to several PDE inhibitors. Defects in this gene are a cause of autosomal dominant striatal degeneration (ADSD). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased uring corticosterone, decreased serum adrenocorticotropin and decreased sensitivity to a PDE8-selective inhibitor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7420426K07Rik T C 9: 98,903,740 S153P probably benign Het
Adarb1 T A 10: 77,325,845 probably benign Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Ank2 A T 3: 126,963,445 N1054K possibly damaging Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Aph1a G T 3: 95,895,531 G148W probably damaging Het
Arsj A G 3: 126,438,154 D183G probably benign Het
Atg2b A G 12: 105,674,950 S76P probably damaging Het
Atxn7l1 C A 12: 33,372,876 N815K probably damaging Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cir1 G A 2: 73,284,503 R404* probably null Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Cstf2t T A 19: 31,084,094 D343E probably damaging Het
Ddx23 A T 15: 98,650,770 D352E possibly damaging Het
Dhx34 G T 7: 16,218,250 A150D possibly damaging Het
Dnal4 A T 15: 79,763,565 V32E possibly damaging Het
Dvl3 G T 16: 20,524,607 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 C T 15: 54,899,330 R174H probably damaging Het
Eps15 G A 4: 109,366,530 probably benign Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fer1l6 A T 15: 58,640,154 D1490V probably damaging Het
Fsd1l A G 4: 53,647,766 K70E probably benign Het
Galnt12 G A 4: 47,113,818 A79T probably damaging Het
Galnt17 A T 5: 130,964,035 M347K probably damaging Het
Glyatl3 A G 17: 40,905,030 V195A probably benign Het
Gm10770 A T 2: 150,179,560 probably null Het
Gm5578 A T 6: 112,606,085 noncoding transcript Het
Grn C A 11: 102,430,554 probably benign Het
Gsk3b G A 16: 38,240,520 R418H probably damaging Het
Hspa12b A G 2: 131,139,508 E221G possibly damaging Het
Ighv1-50 T G 12: 115,120,033 Q22H probably benign Het
Ipcef1 A G 10: 6,919,950 I150T probably benign Het
Ipp T A 4: 116,515,457 F228I possibly damaging Het
Itgb7 A G 15: 102,217,407 C596R probably damaging Het
Kif27 T C 13: 58,291,090 D1219G possibly damaging Het
Lats1 T A 10: 7,691,811 D115E probably benign Het
Lpcat3 A G 6: 124,702,530 N331S probably benign Het
Lrpprc A T 17: 84,751,256 N725K probably benign Het
Lss T G 10: 76,546,236 probably benign Het
Mfsd6 T C 1: 52,708,356 Y450C possibly damaging Het
Mmp21 A T 7: 133,679,013 V76E probably benign Het
Mtmr11 A T 3: 96,169,907 Y527F probably damaging Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Nat10 A T 2: 103,743,293 F327I probably benign Het
Nfkbiz A T 16: 55,818,500 M199K probably damaging Het
Nuak1 A G 10: 84,374,350 Y625H probably benign Het
Odf1 A G 15: 38,226,149 T98A possibly damaging Het
Olfr1274-ps T A 2: 90,400,763 M34K probably benign Het
Olfr1513 T C 14: 52,349,791 N85S probably benign Het
Olfr350 A T 2: 36,850,476 L143F probably benign Het
Oprl1 T A 2: 181,718,610 I153N probably damaging Het
Osbpl8 T A 10: 111,288,693 D705E probably benign Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Paics T C 5: 76,956,822 probably benign Het
Pax5 A G 4: 44,710,407 M1T probably null Het
Pck1 A T 2: 173,153,489 N34I probably benign Het
Piezo2 A G 18: 63,074,620 V1440A probably damaging Het
Ptpre T A 7: 135,652,092 F83Y probably damaging Het
Rassf6 T A 5: 90,604,366 probably null Het
Rilp A T 11: 75,512,708 L325F probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Rprd2 G C 3: 95,765,320 R924G probably benign Het
Rps6kc1 T A 1: 190,773,648 D1039V probably damaging Het
Rufy3 G A 5: 88,645,567 V579I probably benign Het
Serpinc1 A G 1: 160,997,570 probably null Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
St14 T G 9: 31,095,583 D649A probably benign Het
Stab2 A G 10: 86,871,810 probably null Het
Sun3 T C 11: 9,038,287 T12A probably benign Het
Tdrd6 A G 17: 43,626,210 Y1316H probably damaging Het
Thbs3 CAGAAG CAG 3: 89,223,102 probably benign Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Trav14-3 T A 14: 53,763,244 S17T unknown Het
Trmu T A 15: 85,896,355 probably null Het
Ttn T A 2: 76,707,242 T26454S possibly damaging Het
Ubr3 T C 2: 70,020,446 probably benign Het
Unc5b A T 10: 60,775,100 V376E probably benign Het
Usp3 T C 9: 66,542,532 S166G possibly damaging Het
Vldlr C A 19: 27,238,812 C344* probably null Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdfy3 A C 5: 101,944,103 Y457D probably damaging Het
Zbtb2 T C 10: 4,369,267 Y253C possibly damaging Het
Zfp687 A C 3: 95,010,386 F692V probably damaging Het
Zfp758 A G 17: 22,375,405 K291E probably damaging Het
Zfp799 A T 17: 32,820,441 C284S probably damaging Het
Zp1 C A 19: 10,920,562 C5F probably benign Het
Other mutations in Pde8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Pde8b APN 13 95034367 missense probably damaging 1.00
IGL01517:Pde8b APN 13 95100887 critical splice donor site probably null
IGL01736:Pde8b APN 13 95030402 missense probably damaging 1.00
IGL01756:Pde8b APN 13 95046387 missense probably damaging 1.00
IGL01867:Pde8b APN 13 95100938 missense probably damaging 0.99
IGL01939:Pde8b APN 13 95095724 missense probably damaging 0.98
IGL02026:Pde8b APN 13 95034361 missense probably damaging 1.00
IGL02685:Pde8b APN 13 95026120 makesense probably null
IGL02830:Pde8b APN 13 95052901 missense probably benign 0.02
IGL02966:Pde8b APN 13 95095648 missense probably damaging 0.96
IGL03003:Pde8b APN 13 95041957 missense probably damaging 1.00
IGL03064:Pde8b APN 13 95046398 missense probably damaging 1.00
IGL03349:Pde8b APN 13 95043043 splice site probably benign
R0356:Pde8b UTSW 13 95046454 missense probably damaging 0.96
R0464:Pde8b UTSW 13 95104698 missense probably damaging 1.00
R0711:Pde8b UTSW 13 95107817 missense possibly damaging 0.87
R1436:Pde8b UTSW 13 95026170 missense probably benign 0.00
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1494:Pde8b UTSW 13 95047796 missense probably damaging 1.00
R1546:Pde8b UTSW 13 95046443 missense probably damaging 1.00
R1699:Pde8b UTSW 13 95032866 missense probably damaging 1.00
R1795:Pde8b UTSW 13 95042019 missense probably benign 0.10
R1879:Pde8b UTSW 13 95085215 missense possibly damaging 0.95
R2184:Pde8b UTSW 13 95026215 missense probably damaging 1.00
R2223:Pde8b UTSW 13 95043447 missense probably damaging 1.00
R2892:Pde8b UTSW 13 95034259 missense probably damaging 1.00
R3034:Pde8b UTSW 13 95222767 missense probably damaging 1.00
R4204:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4206:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4623:Pde8b UTSW 13 95041939 missense possibly damaging 0.69
R4711:Pde8b UTSW 13 95030450 missense probably benign 0.00
R5133:Pde8b UTSW 13 95086742 missense probably benign 0.05
R5314:Pde8b UTSW 13 95086853 missense possibly damaging 0.89
R5342:Pde8b UTSW 13 95041990 missense probably damaging 0.99
R5376:Pde8b UTSW 13 95026146 missense probably benign 0.00
R5806:Pde8b UTSW 13 95042040 missense probably damaging 1.00
R5830:Pde8b UTSW 13 95041890 missense probably benign 0.01
R6021:Pde8b UTSW 13 95026162 missense possibly damaging 0.47
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6129:Pde8b UTSW 13 95041959 missense probably damaging 0.98
R6181:Pde8b UTSW 13 95086808 missense probably benign 0.36
R6313:Pde8b UTSW 13 95042000 nonsense probably null
R6849:Pde8b UTSW 13 95047799 missense possibly damaging 0.89
R6914:Pde8b UTSW 13 95086844 missense probably benign 0.06
R6999:Pde8b UTSW 13 95086834 missense possibly damaging 0.91
R7149:Pde8b UTSW 13 95086841 missense probably benign 0.03
R7275:Pde8b UTSW 13 95042934 missense not run
Predicted Primers PCR Primer
(F):5'- GGCCTTCCACAAAGCAATTAGC -3'
(R):5'- TGTATACCTGTATCCCCACAGC -3'

Sequencing Primer
(F):5'- GCAATTAGCTCCCGTGGCATC -3'
(R):5'- CCACAGCCTCCCAGTAGG -3'
Posted On2016-06-21