Incidental Mutation 'R5135:Celsr2'
ID396108
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Namecadherin, EGF LAG seven-pass G-type receptor 2
Synonymsmfmi1, EGFL2, flamingo
MMRRC Submission
Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5135 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108390851-108415552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108398659 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 2043 (N2043S)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
Predicted Effect probably damaging
Transcript: ENSMUST00000090558
AA Change: N2043S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: N2043S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130941
Predicted Effect unknown
Transcript: ENSMUST00000147251
AA Change: N31S
SMART Domains Protein: ENSMUSP00000122329
Gene: ENSMUSG00000068740
AA Change: N31S

DomainStartEndE-ValueType
Pfam:GAIN 35 278 5.1e-63 PFAM
GPS 304 357 1.86e-25 SMART
Pfam:7tm_2 362 594 2e-49 PFAM
low complexity region 704 722 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 863 870 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147565
SMART Domains Protein: ENSMUSP00000122516
Gene: ENSMUSG00000068740

DomainStartEndE-ValueType
EGF 13 46 8e-5 SMART
LamG 72 206 1.56e-24 SMART
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T C 1: 184,033,506 S119G probably benign Het
4930553M12Rik G T 4: 88,868,271 H37N unknown Het
Adam10 T A 9: 70,766,074 C496S probably damaging Het
Akap2 G T 4: 57,855,912 A414S probably benign Het
Aldh18a1 A C 19: 40,554,817 probably benign Het
Alox5 A G 6: 116,413,786 F468S probably benign Het
Ankrd50 T C 3: 38,455,803 H805R probably damaging Het
Ap2s1 T A 7: 16,747,323 D72E probably damaging Het
Apaf1 T C 10: 91,060,094 Y372C probably damaging Het
Apob C T 12: 8,010,086 T2823I probably damaging Het
Bhmt A G 13: 93,627,323 V70A probably damaging Het
Cdc42bpg T A 19: 6,320,618 L1247H probably damaging Het
Cel A G 2: 28,559,423 V264A probably benign Het
Clca4a A T 3: 144,954,946 W706R probably damaging Het
Col22a1 G T 15: 71,799,337 P1058Q unknown Het
Cyp4a14 A G 4: 115,489,960 probably null Het
Dhx30 T G 9: 110,098,795 R55S probably damaging Het
Dlgap5 C T 14: 47,399,665 R452H probably damaging Het
Dnah12 T A 14: 26,770,477 D1191E probably damaging Het
Dock3 A T 9: 106,932,997 I164N probably damaging Het
Edrf1 T A 7: 133,651,044 M436K probably benign Het
Eif2ak2 T A 17: 78,866,345 Y268F probably damaging Het
Evi2a G A 11: 79,527,451 T111M possibly damaging Het
Fzd4 A G 7: 89,407,501 E252G probably damaging Het
Gcm2 A G 13: 41,102,959 V438A probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm21994 A T 2: 150,255,490 Y34* probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm4846 T C 1: 166,483,982 D436G probably damaging Het
Gm5414 T A 15: 101,627,768 I141F probably damaging Het
Gm6185 T A 1: 161,198,231 noncoding transcript Het
Grip2 T C 6: 91,773,916 E776G possibly damaging Het
H2-Ob T A 17: 34,243,516 V160E probably benign Het
Hormad1 T C 3: 95,585,220 probably benign Het
Ighv2-1 A T 12: 113,574,462 probably benign Het
Igkv4-92 A T 6: 68,755,554 C14S probably benign Het
Iqsec3 T C 6: 121,383,919 I993M probably damaging Het
Kdm5b T A 1: 134,588,746 probably benign Het
Kitl T C 10: 100,088,222 probably null Het
Klhl26 G T 8: 70,452,718 R100S probably benign Het
Kpna4 C T 3: 69,092,809 probably null Het
Lama5 T A 2: 180,202,220 N383Y possibly damaging Het
Large1 T G 8: 72,818,096 I685L probably benign Het
Larp4b A G 13: 9,170,737 E590G probably damaging Het
Liph A T 16: 21,956,165 C425* probably null Het
Lrrc31 A T 3: 30,684,890 C327* probably null Het
Lrrc36 T C 8: 105,463,898 V733A probably benign Het
Mmel1 T A 4: 154,882,324 I83K probably benign Het
Myo16 G T 8: 10,476,114 V885L probably benign Het
Naip2 A T 13: 100,179,440 N277K probably damaging Het
Ncapg2 T A 12: 116,427,786 I485N possibly damaging Het
Npc1l1 A T 11: 6,224,245 Y687N possibly damaging Het
Obscn A T 11: 59,129,653 V922E probably damaging Het
Oc90 A G 15: 65,883,830 S223P probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1253 A T 2: 89,751,895 L311H possibly damaging Het
Olfr1508 T C 14: 52,463,854 I52V probably benign Het
Pdlim5 C T 3: 142,304,365 R174H probably benign Het
Pex5l G T 3: 32,955,831 A386E probably damaging Het
Plcxd1 T A 5: 110,101,363 probably benign Het
Pramef8 T G 4: 143,419,009 S349R probably benign Het
Prl8a1 A T 13: 27,579,819 probably null Het
Ryr2 G T 13: 11,662,130 N3278K probably benign Het
Sacm1l A G 9: 123,577,025 M324V probably benign Het
Sdad1 T C 5: 92,303,934 T143A probably benign Het
Sec11a A T 7: 80,923,064 probably benign Het
Sema6a A G 18: 47,291,172 V223A probably damaging Het
Serpinb6c A G 13: 33,880,097 V325A probably damaging Het
Slc4a2 G A 5: 24,430,127 A177T possibly damaging Het
Slc5a4a A G 10: 76,147,594 N22D unknown Het
Stard13 C T 5: 151,062,767 W308* probably null Het
Tanc2 C T 11: 105,857,553 L504F possibly damaging Het
Tfap2e G T 4: 126,720,544 N282K probably damaging Het
Uhrf1bp1l T C 10: 89,789,355 I48T probably damaging Het
Usp36 G T 11: 118,264,905 T682K possibly damaging Het
Zc3h11a T C 1: 133,633,789 T315A probably benign Het
Zfa-ps T A 10: 52,543,022 noncoding transcript Het
Zfp663 A T 2: 165,353,670 C210S possibly damaging Het
Zfp747 T C 7: 127,374,394 I201M probably damaging Het
Zic4 C T 9: 91,384,152 T276M probably damaging Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108413879 missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108403270 missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108393763 missense probably benign 0.13
IGL01448:Celsr2 APN 3 108393239 missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108406867 missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108414843 missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108394022 missense probably benign 0.00
IGL02309:Celsr2 APN 3 108396011 missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108412871 missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108413955 missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108397510 missense probably benign 0.01
IGL02812:Celsr2 APN 3 108414113 missense probably benign 0.25
IGL02894:Celsr2 APN 3 108395210 missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108412940 missense probably damaging 1.00
goldeneye UTSW 3 108394919 missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108400838 missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108412499 missense probably damaging 1.00
IGL02799:Celsr2 UTSW 3 108414062 missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108413402 missense probably benign 0.19
R0031:Celsr2 UTSW 3 108413063 missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0090:Celsr2 UTSW 3 108393327 splice site probably benign
R0140:Celsr2 UTSW 3 108397933 missense probably benign 0.00
R0524:Celsr2 UTSW 3 108401587 missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108403895 critical splice donor site probably null
R0662:Celsr2 UTSW 3 108398520 missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108414977 missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108412623 missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108412712 missense probably benign 0.42
R0730:Celsr2 UTSW 3 108398606 missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108401301 missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108414338 missense probably benign
R0989:Celsr2 UTSW 3 108403272 missense probably benign 0.00
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108393739 missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108402483 missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108413520 missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108414095 missense probably benign
R1689:Celsr2 UTSW 3 108407304 missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108401310 missense probably benign 0.35
R1859:Celsr2 UTSW 3 108396630 missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108398650 missense probably benign 0.05
R1974:Celsr2 UTSW 3 108414214 missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108402495 missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108413193 missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108398605 missense probably benign 0.16
R2434:Celsr2 UTSW 3 108404479 missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108413591 missense probably benign 0.11
R3420:Celsr2 UTSW 3 108414416 missense probably benign 0.03
R3712:Celsr2 UTSW 3 108400839 missense probably benign
R3723:Celsr2 UTSW 3 108397415 splice site probably benign
R3809:Celsr2 UTSW 3 108403239 missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108394965 missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108402097 missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108413978 missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108413772 missense probably benign 0.02
R4293:Celsr2 UTSW 3 108393677 missense probably benign 0.01
R4458:Celsr2 UTSW 3 108394997 missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108395216 missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108395969 missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108397231 missense probably benign 0.24
R4732:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108406987 missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108402758 missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108412629 missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108412358 missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108413373 missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108393996 missense probably benign 0.05
R5120:Celsr2 UTSW 3 108393120 missense probably benign 0.02
R5247:Celsr2 UTSW 3 108397630 missense probably benign 0.34
R5381:Celsr2 UTSW 3 108402757 missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108399995 missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108392658 missense probably benign 0.01
R5528:Celsr2 UTSW 3 108413294 missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108402803 missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108396735 missense probably null 0.49
R5697:Celsr2 UTSW 3 108403921 nonsense probably null
R5718:Celsr2 UTSW 3 108393358 missense probably benign
R5869:Celsr2 UTSW 3 108413909 missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108413943 missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108401245 missense probably benign
R6054:Celsr2 UTSW 3 108406963 missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108393128 missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108401214 missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108412574 missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108394919 missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108400501 critical splice donor site probably null
X0020:Celsr2 UTSW 3 108396110 missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108401272 missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108414117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACATCCTGTGTGGCGGATAG -3'
(R):5'- GCTTCGTAAGTTGATCCCTCG -3'

Sequencing Primer
(F):5'- GCGGATAGCCCAAAGCC -3'
(R):5'- CACACCCTTGTCTTTGGAAGTAGAG -3'
Posted On2016-06-21