Incidental Mutation 'R0450:Arih2'
ID39614
Institutional Source Beutler Lab
Gene Symbol Arih2
Ensembl Gene ENSMUSG00000064145
Gene Nameariadne RBR E3 ubiquitin protein ligase 2
SynonymsTRIAD1
MMRRC Submission 038650-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0450 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108602942-108649386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108605092 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 490 (H490L)
Ref Sequence ENSEMBL: ENSMUSP00000013338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013338] [ENSMUST00000193190] [ENSMUST00000193197] [ENSMUST00000193552]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013338
AA Change: H490L

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000013338
Gene: ENSMUSG00000064145
AA Change: H490L

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
RING 138 171 1.21e-1 SMART
IBR 207 269 7.29e-23 SMART
ZnF_C2HC 255 271 2.03e0 SMART
IBR 277 339 1.81e-9 SMART
RING 299 339 5.86e-1 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192853
Predicted Effect probably benign
Transcript: ENSMUST00000193190
SMART Domains Protein: ENSMUSP00000141914
Gene: ENSMUSG00000064145

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
RING 138 171 5.7e-4 SMART
IBR 207 269 2.5e-25 SMART
ZnF_C2HC 255 271 8.4e-3 SMART
Blast:IBR 277 317 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193197
SMART Domains Protein: ENSMUSP00000141911
Gene: ENSMUSG00000064145

DomainStartEndE-ValueType
IBR 1 36 1.5e-3 SMART
ZnF_C2HC 22 38 8.4e-3 SMART
Blast:IBR 44 79 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193923
Predicted Effect probably benign
Transcript: ENSMUST00000194073
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that polyubiquitinates some proteins, tagging them for degradation. The encoded protein upregulates p53 in some cancer cells and may inhibit myelopoiesis. Several transcript variants encoding different isoforms have been found for this gene, although the full-length nature of some of them have not been determined yet. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene causes altered dendritic cell physiology, enhanced liver apoptosis, and complete fetal lethality that is partially modified by genetic background. On a mixed genetic background, mice that survive past weaning succumb to a severe multiorgan inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl G A 2: 127,880,503 probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Cep76 A T 18: 67,634,780 N227K probably benign Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Glipr1l2 A G 10: 112,092,572 D124G probably benign Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hnrnph3 T A 10: 63,018,215 R41S probably benign Het
Hnrnph3 T A 10: 63,019,500 D2V probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mospd3 A G 5: 137,597,032 L233P probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Stk11 T C 10: 80,126,086 V47A probably damaging Het
Tmpo A C 10: 91,163,096 I276M probably benign Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Upb1 T C 10: 75,415,083 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Arih2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Arih2 APN 9 108605410 missense probably damaging 1.00
IGL03213:Arih2 APN 9 108607347 missense probably damaging 1.00
R0009:Arih2 UTSW 9 108611727 missense probably damaging 1.00
R0009:Arih2 UTSW 9 108611727 missense probably damaging 1.00
R0314:Arih2 UTSW 9 108608679 missense probably damaging 1.00
R0413:Arih2 UTSW 9 108616717 missense probably damaging 0.98
R0469:Arih2 UTSW 9 108605092 missense possibly damaging 0.57
R0865:Arih2 UTSW 9 108649300 utr 5 prime probably benign
R2099:Arih2 UTSW 9 108616738 missense probably damaging 1.00
R2913:Arih2 UTSW 9 108644076 missense probably damaging 1.00
R4383:Arih2 UTSW 9 108644277 start codon destroyed probably benign 0.41
R4636:Arih2 UTSW 9 108613814 missense probably damaging 1.00
R5033:Arih2 UTSW 9 108611660 unclassified probably benign
R5562:Arih2 UTSW 9 108607347 missense probably damaging 1.00
R5976:Arih2 UTSW 9 108607973 makesense probably null
R6248:Arih2 UTSW 9 108611642 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATCGGCTAAGAGGTGTGTTGCCAG -3'
(R):5'- AGTTGAGCGTGCAGACAGCTAC -3'

Sequencing Primer
(F):5'- TGCCAGTGTCTTTCAGGAG -3'
(R):5'- CTTCAGGTAATGGAAGGATGTCAC -3'
Posted On2013-05-23