Incidental Mutation 'R0450:Hnrnph3'
ID39617
Institutional Source Beutler Lab
Gene Symbol Hnrnph3
Ensembl Gene ENSMUSG00000020069
Gene Nameheterogeneous nuclear ribonucleoprotein H3
SynonymshnRNP 2H9, Hnrph3
MMRRC Submission 038650-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #R0450 (G1)
Quality Score189
Status Not validated
Chromosome10
Chromosomal Location63014664-63024217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63019500 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 2 (D2V)
Ref Sequence ENSEMBL: ENSMUSP00000118444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020263] [ENSMUST00000118898] [ENSMUST00000119814] [ENSMUST00000124784] [ENSMUST00000140743] [ENSMUST00000143594]
Predicted Effect unknown
Transcript: ENSMUST00000020263
AA Change: D2V
SMART Domains Protein: ENSMUSP00000020263
Gene: ENSMUSG00000020069
AA Change: D2V

DomainStartEndE-ValueType
RRM 17 89 1.11e-7 SMART
low complexity region 102 191 N/A INTRINSIC
RRM 196 266 7.96e-9 SMART
low complexity region 272 286 N/A INTRINSIC
low complexity region 294 341 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000118898
AA Change: D2V
SMART Domains Protein: ENSMUSP00000112424
Gene: ENSMUSG00000020069
AA Change: D2V

DomainStartEndE-ValueType
RRM 17 89 1.11e-7 SMART
low complexity region 102 176 N/A INTRINSIC
RRM 181 251 7.96e-9 SMART
low complexity region 257 271 N/A INTRINSIC
low complexity region 279 326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119814
AA Change: D2V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113134
Gene: ENSMUSG00000020069
AA Change: D2V

DomainStartEndE-ValueType
PDB:1WG5|A 10 39 3e-11 PDB
Blast:RRM 17 43 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124784
SMART Domains Protein: ENSMUSP00000121682
Gene: ENSMUSG00000020072

DomainStartEndE-ValueType
Pfam:PhzC-PhzF 69 175 1.5e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140743
AA Change: D2V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118444
Gene: ENSMUSG00000020069
AA Change: D2V

DomainStartEndE-ValueType
PDB:1WG5|A 10 39 3e-11 PDB
Blast:RRM 17 43 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141616
Predicted Effect probably benign
Transcript: ENSMUST00000143594
SMART Domains Protein: ENSMUSP00000115339
Gene: ENSMUSG00000020070

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 406 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143689
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. It is localized in nuclear bodies of the nucleus. This protein is involved in the splicing process and it also participates in early heat shock-induced splicing arrest by transiently leaving the hnRNP complexes. Several alternatively spliced transcript variants have been noted for this gene, however, not all are fully characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl G A 2: 127,880,503 probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Arih2 T A 9: 108,605,092 H490L possibly damaging Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Cep76 A T 18: 67,634,780 N227K probably benign Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Glipr1l2 A G 10: 112,092,572 D124G probably benign Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mospd3 A G 5: 137,597,032 L233P probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Stk11 T C 10: 80,126,086 V47A probably damaging Het
Tmpo A C 10: 91,163,096 I276M probably benign Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Upb1 T C 10: 75,415,083 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Hnrnph3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Hnrnph3 APN 10 63018124 makesense probably null
IGL02112:Hnrnph3 APN 10 63016405 critical splice donor site probably null
IGL02116:Hnrnph3 APN 10 63016076 intron probably benign
IGL02193:Hnrnph3 APN 10 63017277 missense probably damaging 0.98
IGL02211:Hnrnph3 APN 10 63017342 unclassified probably benign
IGL02410:Hnrnph3 APN 10 63015724 intron probably benign
IGL02616:Hnrnph3 APN 10 63019485 missense possibly damaging 0.66
IGL03033:Hnrnph3 APN 10 63018179 missense probably benign 0.00
IGL03367:Hnrnph3 APN 10 63017229 missense probably damaging 1.00
R0450:Hnrnph3 UTSW 10 63018215 missense probably benign 0.01
R0469:Hnrnph3 UTSW 10 63018215 missense probably benign 0.01
R0469:Hnrnph3 UTSW 10 63019500 missense probably damaging 0.99
R1585:Hnrnph3 UTSW 10 63015800 critical splice donor site probably null
R4285:Hnrnph3 UTSW 10 63016468 missense probably damaging 1.00
R4706:Hnrnph3 UTSW 10 63017280 missense probably damaging 1.00
R5606:Hnrnph3 UTSW 10 63019443 missense possibly damaging 0.94
R5873:Hnrnph3 UTSW 10 63019391 critical splice donor site probably null
R5952:Hnrnph3 UTSW 10 63015595 intron probably benign
R6059:Hnrnph3 UTSW 10 63018862 unclassified probably benign
R6644:Hnrnph3 UTSW 10 63018893 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGCACGATTTCCAACCCTTTAACCC -3'
(R):5'- AGAACACTGTTGCCGACTGTCC -3'

Sequencing Primer
(F):5'- caaaaAGGCTTAGTTTCCCATCACC -3'
(R):5'- GACTGTCCCAGGAGTCACTTTAAC -3'
Posted On2013-05-23