Incidental Mutation 'R0450:Tmpo'
ID39620
Institutional Source Beutler Lab
Gene Symbol Tmpo
Ensembl Gene ENSMUSG00000019961
Gene Namethymopoietin
Synonymslamina-associated polypeptide 2, TP, LAP2, 5630400D24Rik
MMRRC Submission 038650-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0450 (G1)
Quality Score165
Status Not validated
Chromosome10
Chromosomal Location91147571-91181315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 91163096 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 276 (I276M)
Ref Sequence ENSEMBL: ENSMUSP00000020123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020123] [ENSMUST00000072239] [ENSMUST00000092219] [ENSMUST00000099355] [ENSMUST00000105293]
PDB Structure
THE DIMERIZATION DOMAIN OF LAP2ALPHA [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020123
AA Change: I276M

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020123
Gene: ENSMUSG00000019961
AA Change: I276M

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
low complexity region 189 197 N/A INTRINSIC
low complexity region 410 422 N/A INTRINSIC
Pfam:LAP2alpha 459 692 6.4e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072239
SMART Domains Protein: ENSMUSP00000072092
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
low complexity region 226 240 N/A INTRINSIC
transmembrane domain 410 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092219
SMART Domains Protein: ENSMUSP00000089864
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099355
SMART Domains Protein: ENSMUSP00000096956
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105293
SMART Domains Protein: ENSMUSP00000100930
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 301 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217449
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the nucleus and may play a role in the assembly of the nuclear lamina, and thus help maintain the structural organization of the nuclear envelope. It may function as a receptor for the attachment of lamin filaments to the inner nuclear membrane. Mutations in this gene are associated with dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous null for a protein isoform generated from this locus have hyperproliferation of epidermal and erythroid progenitor cells that leads to thickened paws and increased crypt lengths in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl G A 2: 127,880,503 probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Arih2 T A 9: 108,605,092 H490L possibly damaging Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Cep76 A T 18: 67,634,780 N227K probably benign Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Glipr1l2 A G 10: 112,092,572 D124G probably benign Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hnrnph3 T A 10: 63,018,215 R41S probably benign Het
Hnrnph3 T A 10: 63,019,500 D2V probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mospd3 A G 5: 137,597,032 L233P probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Stk11 T C 10: 80,126,086 V47A probably damaging Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Upb1 T C 10: 75,415,083 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Tmpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Tmpo APN 10 91164206 splice site probably benign
IGL00791:Tmpo APN 10 91162558 missense possibly damaging 0.94
IGL00919:Tmpo APN 10 91162800 missense probably damaging 0.99
IGL01382:Tmpo APN 10 91166050 missense probably damaging 1.00
IGL01806:Tmpo APN 10 91163242 missense probably benign 0.01
IGL01813:Tmpo APN 10 91163242 missense probably benign 0.01
IGL01838:Tmpo APN 10 91163242 missense probably benign 0.01
IGL01952:Tmpo APN 10 91163242 missense probably benign 0.01
IGL02110:Tmpo APN 10 91162865 missense probably damaging 1.00
IGL02122:Tmpo APN 10 91164136 missense possibly damaging 0.77
IGL02191:Tmpo APN 10 91161879 missense probably benign 0.00
IGL02338:Tmpo APN 10 91163242 missense probably benign 0.01
PIT4366001:Tmpo UTSW 10 91163310 missense probably damaging 1.00
PIT4544001:Tmpo UTSW 10 91162114 missense probably benign
R0133:Tmpo UTSW 10 91164038 splice site probably benign
R0469:Tmpo UTSW 10 91163096 missense probably benign 0.45
R0836:Tmpo UTSW 10 91161953 nonsense probably null
R2405:Tmpo UTSW 10 91163354 missense probably damaging 1.00
R2919:Tmpo UTSW 10 91152686 missense probably benign 0.23
R4059:Tmpo UTSW 10 91162261 missense probably benign 0.00
R4296:Tmpo UTSW 10 91162956 missense possibly damaging 0.49
R4741:Tmpo UTSW 10 91162644 missense probably benign 0.18
R4881:Tmpo UTSW 10 91162641 missense possibly damaging 0.93
R4915:Tmpo UTSW 10 91149549 missense probably damaging 1.00
R4917:Tmpo UTSW 10 91149549 missense probably damaging 1.00
R4960:Tmpo UTSW 10 91153309 missense probably damaging 1.00
R5002:Tmpo UTSW 10 91164114 missense possibly damaging 0.76
R5301:Tmpo UTSW 10 91149788 intron probably benign
R6167:Tmpo UTSW 10 91162938 missense probably benign
R6190:Tmpo UTSW 10 91164207 splice site probably null
R6979:Tmpo UTSW 10 91152497 intron probably null
Predicted Primers PCR Primer
(F):5'- TCTCGAATTGCCTGAGCAAGTGG -3'
(R):5'- ACCAGTCATGCTTAAACTTCCTGCC -3'

Sequencing Primer
(F):5'- TGACTGATCTGACACGCCAG -3'
(R):5'- TTTTGCCTCTACAGGAAAGAAGAAAG -3'
Posted On2013-05-23