Incidental Mutation 'R5137:Vwa7'
ID396244
Institutional Source Beutler Lab
Gene Symbol Vwa7
Ensembl Gene ENSMUSG00000007030
Gene Namevon Willebrand factor A domain containing 7
SynonymsD17H6S56E-3, G7c
MMRRC Submission 042723-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5137 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35016579-35026741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35017846 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 130 (D130Y)
Ref Sequence ENSEMBL: ENSMUSP00000133418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007245] [ENSMUST00000087315] [ENSMUST00000172499] [ENSMUST00000173584]
Predicted Effect probably damaging
Transcript: ENSMUST00000007245
AA Change: D130Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007245
Gene: ENSMUSG00000007030
AA Change: D130Y

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 499 2.59e0 SMART
low complexity region 683 701 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 864 877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087315
SMART Domains Protein: ENSMUSP00000084572
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
Pfam:GST_N 2 81 5.7e-16 PFAM
Pfam:GST_C 107 198 7.3e-13 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 2e-197 PFAM
Pfam:tRNA-synt_1g 336 496 6e-6 PFAM
Pfam:tRNA-synt_1_2 555 623 1.9e-11 PFAM
Pfam:Anticodon_1 983 1138 2.6e-34 PFAM
low complexity region 1153 1174 N/A INTRINSIC
low complexity region 1207 1225 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172499
AA Change: D130Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133418
Gene: ENSMUSG00000007030
AA Change: D130Y

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 478 7.28e0 SMART
low complexity region 662 680 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
low complexity region 843 856 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172999
Predicted Effect probably benign
Transcript: ENSMUST00000173142
SMART Domains Protein: ENSMUSP00000134669
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
SCOP:d1gaxa3 32 67 3e-7 SMART
PDB:1IYW|B 36 122 4e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173336
Predicted Effect probably benign
Transcript: ENSMUST00000173584
SMART Domains Protein: ENSMUSP00000133994
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
Pfam:GST_C 96 198 7.8e-14 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 1.9e-200 PFAM
Pfam:tRNA-synt_1g 336 493 2.1e-7 PFAM
Pfam:tRNA-synt_1_2 555 623 1.1e-12 PFAM
Pfam:Anticodon_1 983 1138 7.2e-36 PFAM
low complexity region 1153 1174 N/A INTRINSIC
coiled coil region 1197 1225 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174084
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,069,771 V75A probably benign Het
Ace G C 11: 105,974,826 W628C probably damaging Het
Adh4 T C 3: 138,422,235 S141P probably benign Het
Apob T C 12: 8,011,384 Y3256H possibly damaging Het
B3galnt1 G T 3: 69,574,949 N326K probably benign Het
Catsperb T C 12: 101,549,811 F569L probably damaging Het
Cecr2 A G 6: 120,755,517 I225V probably benign Het
Cox5b A G 1: 36,692,429 probably null Het
Crybg1 T C 10: 43,958,336 D1953G probably damaging Het
Dnaaf5 C T 5: 139,181,460 T707M probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Ebf1 G A 11: 44,991,468 R409Q probably damaging Het
Eef2k G A 7: 120,885,422 A256T probably damaging Het
Eef2k C A 7: 120,885,423 A256D probably damaging Het
Evl C G 12: 108,681,522 T294S probably benign Het
Eya2 T C 2: 165,731,628 Y288H probably damaging Het
Ezh2 A T 6: 47,532,080 probably null Het
Fam171a1 T C 2: 3,225,389 Y395H probably benign Het
Gas2l3 C A 10: 89,413,975 R427L probably damaging Het
Gli2 T A 1: 118,855,503 I91F probably damaging Het
Gm4884 T C 7: 41,042,894 S96P probably damaging Het
Gprc5d T A 6: 135,116,033 D292V probably benign Het
Herc1 A G 9: 66,448,223 K2252R probably benign Het
Il1rl1 A T 1: 40,450,125 M346L probably benign Het
Kcna5 A T 6: 126,533,983 V394D probably damaging Het
Kcng4 A T 8: 119,625,878 M431K possibly damaging Het
Kif1bp A T 10: 62,578,241 V46E probably damaging Het
Large1 A G 8: 73,048,309 F258L possibly damaging Het
Mapkbp1 T A 2: 120,022,181 C1001S probably damaging Het
Micu1 A G 10: 59,827,232 Q328R probably benign Het
Mmp11 G A 10: 75,925,456 P437S probably damaging Het
Msh6 T A 17: 87,980,288 F119I possibly damaging Het
Myo6 A G 9: 80,242,249 E159G probably damaging Het
Negr1 T A 3: 157,016,196 Y136N probably damaging Het
Nol9 T A 4: 152,045,971 C321S probably damaging Het
Nos1 T C 5: 117,905,313 F551S probably benign Het
Nup153 C A 13: 46,684,153 G1198C probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1225 C A 2: 89,170,400 V271F probably benign Het
Olfr395 T C 11: 73,906,626 I289V probably damaging Het
Olfr606 A G 7: 103,451,712 Y125C probably damaging Het
Olfr606 C A 7: 103,451,713 Y125* probably null Het
Omd T C 13: 49,590,076 S201P probably benign Het
Oxct1 G T 15: 4,035,350 A57S probably benign Het
Pcdhga7 T G 18: 37,717,380 S813R probably damaging Het
Pcmtd2 A T 2: 181,854,994 I255F possibly damaging Het
Pdk1 T G 2: 71,883,569 M186R possibly damaging Het
Pelp1 T C 11: 70,395,099 T648A probably damaging Het
Phldb2 A T 16: 45,808,258 S570R possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Ptprj T C 2: 90,469,648 T270A possibly damaging Het
Reln C T 5: 21,955,181 G2130D probably damaging Het
Rims1 A T 1: 22,288,620 Y663* probably null Het
Rit2 T C 18: 31,153,764 T123A probably benign Het
Rmdn2 A T 17: 79,667,989 E302D probably benign Het
Ryr1 T C 7: 29,101,858 E827G possibly damaging Het
Siglec1 C T 2: 131,081,344 G494R probably damaging Het
Slc16a14 T A 1: 84,912,597 Y329F probably damaging Het
Slc35d1 A T 4: 103,214,781 L8Q possibly damaging Het
Smpdl3a C T 10: 57,801,067 S57L possibly damaging Het
Snx9 T C 17: 5,928,253 V566A probably damaging Het
Spaca1 A T 4: 34,029,095 I126N probably damaging Het
Spred1 T G 2: 117,163,571 I94S probably damaging Het
Tardbp T C 4: 148,622,037 D105G possibly damaging Het
Tet2 T C 3: 133,476,565 S1213G probably benign Het
Trak1 A T 9: 121,367,055 probably benign Het
Trem3 G A 17: 48,249,728 V76M possibly damaging Het
Ttc13 G T 8: 124,694,935 Y250* probably null Het
Ttll5 T G 12: 85,923,045 S714R possibly damaging Het
Ube2l6 T G 2: 84,802,876 probably null Het
Ubr3 T C 2: 69,973,335 S1090P probably damaging Het
Uhrf1bp1 T G 17: 27,876,990 probably null Het
Vezt T C 10: 93,970,510 T680A probably benign Het
Virma A G 4: 11,546,297 K1762E probably damaging Het
Vps53 A G 11: 76,166,248 S57P probably damaging Het
Vwa8 T G 14: 79,064,902 F1004V probably damaging Het
Zfp35 A T 18: 24,004,137 K513* probably null Het
Zfp384 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 6: 125,036,509 probably benign Het
Zfp521 C A 18: 13,845,448 C636F probably damaging Het
Other mutations in Vwa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Vwa7 APN 17 35024942 missense probably damaging 1.00
IGL01736:Vwa7 APN 17 35019851 missense probably damaging 1.00
IGL01868:Vwa7 APN 17 35021259 missense probably null 0.96
IGL01920:Vwa7 APN 17 35024603 missense probably benign 0.01
IGL02227:Vwa7 APN 17 35020084 missense probably damaging 1.00
IGL02947:Vwa7 APN 17 35023500 splice site probably null
IGL03259:Vwa7 APN 17 35020026 unclassified probably null
IGL03263:Vwa7 APN 17 35021599 missense probably benign 0.16
R0008:Vwa7 UTSW 17 35019805 missense probably benign 0.33
R0057:Vwa7 UTSW 17 35024547 missense possibly damaging 0.85
R0057:Vwa7 UTSW 17 35024547 missense possibly damaging 0.85
R0418:Vwa7 UTSW 17 35017957 missense possibly damaging 0.57
R0538:Vwa7 UTSW 17 35022651 missense probably damaging 1.00
R1121:Vwa7 UTSW 17 35017794 missense probably damaging 1.00
R1659:Vwa7 UTSW 17 35019071 missense probably benign 0.04
R1766:Vwa7 UTSW 17 35023943 critical splice donor site probably null
R1777:Vwa7 UTSW 17 35024948 missense probably damaging 1.00
R1793:Vwa7 UTSW 17 35024412 nonsense probably null
R1874:Vwa7 UTSW 17 35017112 missense probably benign 0.00
R2139:Vwa7 UTSW 17 35023430 missense probably benign 0.00
R2248:Vwa7 UTSW 17 35019043 missense probably benign 0.04
R2290:Vwa7 UTSW 17 35017211 missense probably damaging 1.00
R2869:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2869:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2870:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2870:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2871:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2871:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2873:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2874:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R3038:Vwa7 UTSW 17 35022661 missense probably damaging 1.00
R3792:Vwa7 UTSW 17 35025159 unclassified probably null
R3970:Vwa7 UTSW 17 35017708 missense probably damaging 1.00
R4612:Vwa7 UTSW 17 35023450 missense probably damaging 0.96
R5013:Vwa7 UTSW 17 35022733 missense probably damaging 1.00
R5068:Vwa7 UTSW 17 35024190 missense probably benign 0.25
R5069:Vwa7 UTSW 17 35024190 missense probably benign 0.25
R5070:Vwa7 UTSW 17 35024190 missense probably benign 0.25
R5384:Vwa7 UTSW 17 35024926 unclassified probably null
R6170:Vwa7 UTSW 17 35021210 missense possibly damaging 0.56
R6229:Vwa7 UTSW 17 35024265 missense probably benign 0.00
R6249:Vwa7 UTSW 17 35023389 missense probably benign 0.00
R6401:Vwa7 UTSW 17 35017310 splice site probably null
R6429:Vwa7 UTSW 17 35024199 missense probably benign 0.32
R6678:Vwa7 UTSW 17 35019800 missense probably damaging 1.00
R6793:Vwa7 UTSW 17 35024891 missense probably benign 0.06
R6966:Vwa7 UTSW 17 35017096 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAACCACTCTTGCTAGGGCC -3'
(R):5'- TTGTAGCTACTCCTGGCCAGAC -3'

Sequencing Primer
(F):5'- TCTTGCTAGGGCCGGACC -3'
(R):5'- AAGTGCTGCCAGCTCAG -3'
Posted On2016-06-21