Incidental Mutation 'R0450:Parp2'
ID39634
Institutional Source Beutler Lab
Gene Symbol Parp2
Ensembl Gene ENSMUSG00000036023
Gene Namepoly (ADP-ribose) polymerase family, member 2
SynonymsPARP-2, Adprtl2, C78626, Aspartl2, Adprt2
MMRRC Submission 038650-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.758) question?
Stock #R0450 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50807841-50821301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50819673 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 361 (Y361N)
Ref Sequence ENSEMBL: ENSMUSP00000048877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006444] [ENSMUST00000036126] [ENSMUST00000227810]
PDB Structure
CRYSTAL STRUCTURE OF THE CATALYTIC FRAGMENT OF MURINE POLY (ADP-RIBOSE) POLYMERASE-2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000006444
SMART Domains Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281

DomainStartEndE-ValueType
Pfam:TEP1_N 1 29 2.8e-20 PFAM
Pfam:TEP1_N 31 59 1.4e-20 PFAM
Pfam:TEP1_N 61 89 3.1e-20 PFAM
Pfam:TEP1_N 91 119 3e-20 PFAM
low complexity region 195 207 N/A INTRINSIC
low complexity region 211 229 N/A INTRINSIC
Pfam:TROVE 230 685 3.2e-136 PFAM
Pfam:DUF4062 909 1020 2.4e-22 PFAM
Pfam:NACHT 1171 1346 9.2e-38 PFAM
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1622 1641 N/A INTRINSIC
WD40 1673 1711 2.98e-1 SMART
WD40 1714 1752 5.33e0 SMART
WD40 1755 1794 1.52e-4 SMART
WD40 1797 1835 3.27e-4 SMART
WD40 1838 1877 3.09e-1 SMART
WD40 1880 1919 2.24e-2 SMART
WD40 1925 1962 4.95e0 SMART
WD40 1968 2003 2.29e1 SMART
WD40 2008 2045 1.72e0 SMART
WD40 2058 2097 3.89e-11 SMART
WD40 2103 2142 3.93e-7 SMART
WD40 2145 2182 4.38e-5 SMART
WD40 2184 2232 1.24e0 SMART
WD40 2235 2273 1.14e-3 SMART
WD40 2275 2315 4.46e-1 SMART
Blast:WD40 2316 2353 4e-12 BLAST
WD40 2546 2583 6.79e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000036126
AA Change: Y361N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048877
Gene: ENSMUSG00000036023
AA Change: Y361N

DomainStartEndE-ValueType
WGR 95 175 1.17e-35 SMART
Pfam:PARP_reg 208 338 1.4e-49 PFAM
Pfam:PARP 341 553 1.8e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226222
Predicted Effect probably benign
Transcript: ENSMUST00000226430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226880
Predicted Effect probably benign
Transcript: ENSMUST00000227810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228872
Meta Mutation Damage Score 0.458 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 2 protein, which contains a catalytic domain and is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. The basic residues within the N-terminal region of this protein may bear potential DNA-binding properties, and may be involved in the nuclear and/or nucleolar targeting of the protein. Two alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals are sensitive to gamma radiation. Epithelial crypt degeneration and DNA repair deficiency is apparent following radiation-induced injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl G A 2: 127,880,503 probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Arih2 T A 9: 108,605,092 H490L possibly damaging Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Cep76 A T 18: 67,634,780 N227K probably benign Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Glipr1l2 A G 10: 112,092,572 D124G probably benign Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hnrnph3 T A 10: 63,018,215 R41S probably benign Het
Hnrnph3 T A 10: 63,019,500 D2V probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mospd3 A G 5: 137,597,032 L233P probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Stk11 T C 10: 80,126,086 V47A probably damaging Het
Tmpo A C 10: 91,163,096 I276M probably benign Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Upb1 T C 10: 75,415,083 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Parp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02826:Parp2 APN 14 50815415 missense probably benign 0.04
IGL03022:Parp2 APN 14 50821096 missense probably damaging 0.99
IGL03051:Parp2 APN 14 50819348 splice site probably benign
R0110:Parp2 UTSW 14 50819673 missense probably damaging 1.00
R0510:Parp2 UTSW 14 50819673 missense probably damaging 1.00
R1442:Parp2 UTSW 14 50819275 critical splice donor site probably null
R1590:Parp2 UTSW 14 50810544 missense probably benign 0.19
R1668:Parp2 UTSW 14 50820856 missense probably benign 0.00
R1806:Parp2 UTSW 14 50819379 missense probably damaging 0.99
R1846:Parp2 UTSW 14 50815386 nonsense probably null
R2029:Parp2 UTSW 14 50810086 missense probably benign 0.14
R2990:Parp2 UTSW 14 50817000 missense probably benign
R3933:Parp2 UTSW 14 50819387 missense probably benign 0.44
R4921:Parp2 UTSW 14 50819268 missense probably damaging 0.99
R6406:Parp2 UTSW 14 50819477 missense probably benign
R6799:Parp2 UTSW 14 50821096 missense probably damaging 0.99
R7105:Parp2 UTSW 14 50810064 frame shift probably null
R7250:Parp2 UTSW 14 50817344 missense probably benign
X0019:Parp2 UTSW 14 50817099 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTTAAACTGGTGAAGTCAGAGC -3'
(R):5'- ATGCCAGAGCAGCATCCTAAGAAAG -3'

Sequencing Primer
(F):5'- GTCCTCTGGACCATGAAAGTAATG -3'
(R):5'- CCTAAGAAAGAGCCATTAGTTTCCTC -3'
Posted On2013-05-23