Incidental Mutation 'R5139:Mical1'
ID396354
Institutional Source Beutler Lab
Gene Symbol Mical1
Ensembl Gene ENSMUSG00000019823
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 1
SynonymsNical
MMRRC Submission 042725-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R5139 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location41476314-41487032 bp(+) (GRCm38)
Type of Mutationunclassified (230 bp from exon)
DNA Base Change (assembly) T to A at 41478415 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019967] [ENSMUST00000099934] [ENSMUST00000119962] [ENSMUST00000126436] [ENSMUST00000151486]
Predicted Effect probably null
Transcript: ENSMUST00000019967
SMART Domains Protein: ENSMUSP00000019967
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 5.5e-8 PFAM
Pfam:FAD_binding_2 86 125 6.1e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099934
SMART Domains Protein: ENSMUSP00000097519
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
PDB:2C4C|B 1 86 5e-49 PDB
low complexity region 87 98 N/A INTRINSIC
PDB:2C4C|B 99 416 N/A PDB
CH 436 533 4.18e-13 SMART
low complexity region 576 593 N/A INTRINSIC
LIM 609 663 2.07e-3 SMART
low complexity region 693 712 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 782 804 N/A INTRINSIC
DUF3585 839 975 3.07e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119962
SMART Domains Protein: ENSMUSP00000113783
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 7.2e-8 PFAM
Pfam:FAD_binding_2 86 125 3.8e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125730
Predicted Effect probably benign
Transcript: ENSMUST00000126436
SMART Domains Protein: ENSMUSP00000114969
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 1.1e-7 PFAM
Pfam:FAD_binding_2 86 125 3.2e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136681
Predicted Effect probably null
Transcript: ENSMUST00000151486
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that oxidizes methionine residues on actin, thereby promoting depolymerization of actin filaments. This protein interacts with and regulates signalling by NEDD9/CAS-L (neural precursor cell expressed, developmentally down-regulated 9). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,448 L625P probably damaging Het
Agtpbp1 A G 13: 59,500,213 S598P probably damaging Het
Ahnak A C 19: 9,004,655 D1101A probably damaging Het
Aoah T C 13: 21,023,237 V542A possibly damaging Het
Aox1 T C 1: 58,061,297 S418P probably benign Het
Appl1 A G 14: 26,947,155 I354T probably benign Het
BC035947 T C 1: 78,499,247 E216G possibly damaging Het
Bnip3l A G 14: 66,999,615 S63P probably damaging Het
C130060K24Rik A T 6: 65,456,219 N341I probably damaging Het
Cckar T C 5: 53,702,923 N188S probably benign Het
Ccl24 C T 5: 135,572,921 A18T probably benign Het
Cmya5 A G 13: 93,096,061 C840R probably benign Het
Copa C T 1: 172,121,329 R1183W probably damaging Het
Dnah10 T C 5: 124,798,960 V2621A probably damaging Het
Fryl A G 5: 73,090,718 Y1019H probably damaging Het
Hira T C 16: 18,954,758 Y943H probably damaging Het
Ighv3-8 T C 12: 114,322,374 Y116C probably damaging Het
Igkv4-70 G A 6: 69,268,105 T44I probably damaging Het
Lce3c G A 3: 92,945,471 G80S unknown Het
Ldhb A T 6: 142,494,195 N206K probably damaging Het
Myh2 T C 11: 67,179,348 L402P probably damaging Het
Naa15 T A 3: 51,443,840 L144I probably damaging Het
Nbea T A 3: 55,626,963 I2918F possibly damaging Het
Olfr1131 C A 2: 87,628,656 H64Q probably benign Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pdlim7 A G 13: 55,507,056 S214P probably damaging Het
Polg T C 7: 79,450,025 D49G probably damaging Het
Polr2f C A 15: 79,151,658 D106E possibly damaging Het
Ppp6r3 A C 19: 3,464,610 N766K probably damaging Het
Prl8a1 T A 13: 27,574,066 D220V probably damaging Het
Sept9 A G 11: 117,356,685 K497E possibly damaging Het
Sfswap T G 5: 129,571,009 M927R possibly damaging Het
Smad9 T G 3: 54,797,406 W400G possibly damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tesmin A G 19: 3,406,934 I238V probably damaging Het
Trf C T 9: 103,222,934 probably null Het
Trpc3 A T 3: 36,671,557 M90K possibly damaging Het
Tshz3 C T 7: 36,771,025 T813I probably benign Het
Tub T A 7: 109,011,102 M1K probably null Het
Wdfy3 A T 5: 101,849,267 probably null Het
Zfp853 T C 5: 143,288,815 Q350R unknown Het
Other mutations in Mical1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Mical1 APN 10 41479069 critical splice donor site probably null
IGL01594:Mical1 APN 10 41480329 missense probably damaging 1.00
IGL02065:Mical1 APN 10 41484411 missense possibly damaging 0.55
IGL02321:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02323:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02324:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02327:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02416:Mical1 APN 10 41484810 critical splice donor site probably null
IGL02419:Mical1 APN 10 41482277 missense possibly damaging 0.73
IGL03027:Mical1 APN 10 41479505 unclassified probably benign
IGL03087:Mical1 APN 10 41482690 missense probably damaging 1.00
IGL03368:Mical1 APN 10 41479629 missense probably damaging 0.96
IGL03387:Mical1 APN 10 41478199 missense probably damaging 1.00
PIT1430001:Mical1 UTSW 10 41483496 missense possibly damaging 0.55
R0433:Mical1 UTSW 10 41479490 missense probably benign 0.15
R0617:Mical1 UTSW 10 41481315 missense probably damaging 0.97
R0638:Mical1 UTSW 10 41482239 missense probably benign 0.01
R1535:Mical1 UTSW 10 41485211 missense possibly damaging 0.55
R1623:Mical1 UTSW 10 41481393 critical splice donor site probably null
R1712:Mical1 UTSW 10 41480363 missense probably damaging 1.00
R1806:Mical1 UTSW 10 41478214 missense probably damaging 0.96
R1835:Mical1 UTSW 10 41483535 missense probably benign 0.00
R1866:Mical1 UTSW 10 41485470 missense probably benign 0.39
R2134:Mical1 UTSW 10 41482712 missense probably damaging 1.00
R2352:Mical1 UTSW 10 41482233 missense probably benign 0.21
R3740:Mical1 UTSW 10 41479071 missense probably benign 0.01
R4033:Mical1 UTSW 10 41481176 missense probably benign 0.40
R4093:Mical1 UTSW 10 41486937 unclassified probably benign
R4184:Mical1 UTSW 10 41481870 unclassified probably benign
R4194:Mical1 UTSW 10 41481628 missense possibly damaging 0.88
R4659:Mical1 UTSW 10 41486936 unclassified probably benign
R5173:Mical1 UTSW 10 41484989 missense probably damaging 1.00
R5340:Mical1 UTSW 10 41483431 splice site probably null
R5501:Mical1 UTSW 10 41486079 missense probably benign 0.01
R5560:Mical1 UTSW 10 41478965 missense probably damaging 1.00
R5726:Mical1 UTSW 10 41483696 unclassified probably benign
R5864:Mical1 UTSW 10 41486068 missense possibly damaging 0.88
R5905:Mical1 UTSW 10 41486877 missense probably benign 0.00
R6028:Mical1 UTSW 10 41486877 missense probably benign 0.00
R6047:Mical1 UTSW 10 41481707 critical splice donor site probably null
R6074:Mical1 UTSW 10 41486065 missense probably benign 0.27
R6458:Mical1 UTSW 10 41484735 missense probably benign 0.44
R6879:Mical1 UTSW 10 41484519 missense probably damaging 0.99
R6966:Mical1 UTSW 10 41479754 missense probably damaging 0.98
R7049:Mical1 UTSW 10 41482250 missense possibly damaging 0.63
X0020:Mical1 UTSW 10 41478996 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGTGCCAAGTCACTGTG -3'
(R):5'- TACTGATATGGTCCAGGGTGCC -3'

Sequencing Primer
(F):5'- CAAGTCACTGTGGGCCAAGTTG -3'
(R):5'- AAGCGCCCGTAGAACTTCTTG -3'
Posted On2016-06-21