Incidental Mutation 'R0450:Ap2m1'
ID39640
Institutional Source Beutler Lab
Gene Symbol Ap2m1
Ensembl Gene ENSMUSG00000022841
Gene Nameadaptor-related protein complex 2, mu 1 subunit
Synonymsclathrin-associated AP-2
MMRRC Submission 038650-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0450 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location20535478-20544909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20542240 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 334 (I334N)
Ref Sequence ENSEMBL: ENSMUSP00000087477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007216] [ENSMUST00000090023] [ENSMUST00000126788] [ENSMUST00000232001]
Predicted Effect probably benign
Transcript: ENSMUST00000007216
AA Change: I336N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000007216
Gene: ENSMUSG00000022841
AA Change: I336N

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 137 6.7e-8 PFAM
Pfam:Adap_comp_sub 159 435 3.2e-84 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090023
AA Change: I334N

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000087477
Gene: ENSMUSG00000022841
AA Change: I334N

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 137 4.2e-8 PFAM
Pfam:Adap_comp_sub 157 433 8.7e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119553
Predicted Effect probably benign
Transcript: ENSMUST00000126788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231978
Predicted Effect probably benign
Transcript: ENSMUST00000232001
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the mu subunit of the clathrin adaptor protein complex AP-2. It mediates sorting of cargo proteins harboring Y-X-X-Phi motifs into clathrin-coated vesicles. Alternate splicing of this gene results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 2, 8 and 19. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted deletion display embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl G A 2: 127,880,503 probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Arih2 T A 9: 108,605,092 H490L possibly damaging Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Cep76 A T 18: 67,634,780 N227K probably benign Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Glipr1l2 A G 10: 112,092,572 D124G probably benign Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hnrnph3 T A 10: 63,018,215 R41S probably benign Het
Hnrnph3 T A 10: 63,019,500 D2V probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mospd3 A G 5: 137,597,032 L233P probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Stk11 T C 10: 80,126,086 V47A probably damaging Het
Tmpo A C 10: 91,163,096 I276M probably benign Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Upb1 T C 10: 75,415,083 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Ap2m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Ap2m1 APN 16 20542194 unclassified probably benign
R0110:Ap2m1 UTSW 16 20542240 missense possibly damaging 0.67
R0390:Ap2m1 UTSW 16 20541099 missense probably damaging 0.98
R0510:Ap2m1 UTSW 16 20542240 missense possibly damaging 0.67
R1386:Ap2m1 UTSW 16 20541229 missense probably damaging 1.00
R1505:Ap2m1 UTSW 16 20542697 missense probably benign
R1728:Ap2m1 UTSW 16 20539338 missense probably damaging 0.99
R1729:Ap2m1 UTSW 16 20539338 missense probably damaging 0.99
R4433:Ap2m1 UTSW 16 20543384 missense possibly damaging 0.55
R5773:Ap2m1 UTSW 16 20543390 missense probably damaging 0.96
R6953:Ap2m1 UTSW 16 20542718 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGTCATCAAGTCCAACTTCAAGCCC -3'
(R):5'- CACCCAGACTGTACGCTTTAGACAC -3'

Sequencing Primer
(F):5'- AACTTCAAGCCCTCACTTCTGG -3'
(R):5'- cacacacacacacacacac -3'
Posted On2013-05-23