Incidental Mutation 'R0450:Plcl2'
ID39641
Institutional Source Beutler Lab
Gene Symbol Plcl2
Ensembl Gene ENSMUSG00000038910
Gene Namephospholipase C-like 2
SynonymsPRIP-2, Plce2
MMRRC Submission 038650-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.639) question?
Stock #R0450 (G1)
Quality Score151
Status Not validated
Chromosome17
Chromosomal Location50509547-50688493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50607982 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 673 (L673P)
Ref Sequence ENSEMBL: ENSMUSP00000046584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043938]
Predicted Effect probably damaging
Transcript: ENSMUST00000043938
AA Change: L673P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046584
Gene: ENSMUSG00000038910
AA Change: L673P

DomainStartEndE-ValueType
low complexity region 20 49 N/A INTRINSIC
PH 143 254 2.88e-5 SMART
Pfam:EF-hand_like 344 426 3.7e-29 PFAM
PLCXc 427 571 2.19e-84 SMART
PLCYc 619 735 4.37e-61 SMART
C2 756 862 3.45e-19 SMART
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Inactivation of this gene is compatible with normal immune cell development, though the B cell response is dysregulated. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl G A 2: 127,880,503 probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Arih2 T A 9: 108,605,092 H490L possibly damaging Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Cep76 A T 18: 67,634,780 N227K probably benign Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Glipr1l2 A G 10: 112,092,572 D124G probably benign Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hnrnph3 T A 10: 63,018,215 R41S probably benign Het
Hnrnph3 T A 10: 63,019,500 D2V probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mospd3 A G 5: 137,597,032 L233P probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Stk11 T C 10: 80,126,086 V47A probably damaging Het
Tmpo A C 10: 91,163,096 I276M probably benign Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Upb1 T C 10: 75,415,083 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Plcl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Plcl2 APN 17 50606920 missense probably benign 0.01
IGL01746:Plcl2 APN 17 50607696 missense probably benign 0.00
IGL02227:Plcl2 APN 17 50606397 missense probably damaging 0.97
IGL02232:Plcl2 APN 17 50606641 missense possibly damaging 0.66
IGL02878:Plcl2 APN 17 50607355 missense probably damaging 1.00
IGL02985:Plcl2 APN 17 50687814 nonsense probably null
parece UTSW 17 50607846 missense probably damaging 0.99
verdad UTSW 17 50608081 missense probably damaging 1.00
IGL03014:Plcl2 UTSW 17 50611001 missense possibly damaging 0.65
R0110:Plcl2 UTSW 17 50607982 missense probably damaging 1.00
R0190:Plcl2 UTSW 17 50607643 missense probably benign
R0280:Plcl2 UTSW 17 50607034 missense probably damaging 1.00
R0414:Plcl2 UTSW 17 50607955 missense possibly damaging 0.90
R0760:Plcl2 UTSW 17 50608774 missense possibly damaging 0.82
R1134:Plcl2 UTSW 17 50608110 missense probably benign
R1168:Plcl2 UTSW 17 50607072 missense possibly damaging 0.49
R1381:Plcl2 UTSW 17 50607729 missense probably damaging 0.99
R1748:Plcl2 UTSW 17 50606798 missense probably benign
R1856:Plcl2 UTSW 17 50607850 missense probably benign 0.13
R1958:Plcl2 UTSW 17 50608081 missense probably damaging 1.00
R2016:Plcl2 UTSW 17 50606694 missense probably damaging 1.00
R2057:Plcl2 UTSW 17 50668111 splice site probably null
R2077:Plcl2 UTSW 17 50606829 missense probably benign
R2247:Plcl2 UTSW 17 50606845 missense probably damaging 0.96
R3083:Plcl2 UTSW 17 50687744 missense probably benign 0.06
R4153:Plcl2 UTSW 17 50606361 nonsense probably null
R4574:Plcl2 UTSW 17 50607846 missense probably damaging 0.99
R4870:Plcl2 UTSW 17 50607226 missense possibly damaging 0.46
R5030:Plcl2 UTSW 17 50607319 missense possibly damaging 0.92
R5330:Plcl2 UTSW 17 50509848 missense probably benign 0.01
R5331:Plcl2 UTSW 17 50509848 missense probably benign 0.01
R5503:Plcl2 UTSW 17 50509929 missense probably benign 0.00
R5920:Plcl2 UTSW 17 50608675 missense probably damaging 0.99
R6238:Plcl2 UTSW 17 50606845 missense probably damaging 0.96
R6378:Plcl2 UTSW 17 50668160 intron probably null
R6603:Plcl2 UTSW 17 50607117 missense probably benign 0.03
R6633:Plcl2 UTSW 17 50640140 missense probably benign 0.00
R7113:Plcl2 UTSW 17 50606464 missense probably damaging 1.00
X0026:Plcl2 UTSW 17 50607560 missense probably benign 0.03
Z1088:Plcl2 UTSW 17 50606992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAACCATGTGCCTGTGAAG -3'
(R):5'- TGAAGCAACTGAGGTGAAACTCCTG -3'

Sequencing Primer
(F):5'- CCTGTGAAGCGGTTTCAGC -3'
(R):5'- AAGGAGACTTCTTCCCTCATGATG -3'
Posted On2013-05-23