Incidental Mutation 'R0450:Cep76'
ID39643
Institutional Source Beutler Lab
Gene Symbol Cep76
Ensembl Gene ENSMUSG00000073542
Gene Namecentrosomal protein 76
Synonyms
MMRRC Submission 038650-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0450 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location67617397-67641336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67634780 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 227 (N227K)
Ref Sequence ENSEMBL: ENSMUSP00000095149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097542]
Predicted Effect probably benign
Transcript: ENSMUST00000097542
AA Change: N227K

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095149
Gene: ENSMUSG00000073542
AA Change: N227K

DomainStartEndE-ValueType
Pfam:CEP76-C2 99 258 4.1e-64 PFAM
low complexity region 383 393 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Blast:KIND 604 654 2e-27 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein which regulates centriole amplification by limiting centriole duplication to once per cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl G A 2: 127,880,503 probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Arih2 T A 9: 108,605,092 H490L possibly damaging Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Glipr1l2 A G 10: 112,092,572 D124G probably benign Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hnrnph3 T A 10: 63,018,215 R41S probably benign Het
Hnrnph3 T A 10: 63,019,500 D2V probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mospd3 A G 5: 137,597,032 L233P probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Stk11 T C 10: 80,126,086 V47A probably damaging Het
Tmpo A C 10: 91,163,096 I276M probably benign Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Upb1 T C 10: 75,415,083 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Cep76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Cep76 APN 18 67640117 missense probably benign 0.01
IGL01344:Cep76 APN 18 67623397 missense possibly damaging 0.95
IGL02426:Cep76 APN 18 67634917 missense probably benign
IGL02544:Cep76 APN 18 67634950 splice site probably benign
IGL02711:Cep76 APN 18 67638336 missense probably benign
IGL03283:Cep76 APN 18 67640069 missense possibly damaging 0.76
R0117:Cep76 UTSW 18 67626674 missense possibly damaging 0.91
R0469:Cep76 UTSW 18 67634780 missense probably benign 0.30
R0587:Cep76 UTSW 18 67623175 nonsense probably null
R0658:Cep76 UTSW 18 67623304 missense probably damaging 1.00
R0667:Cep76 UTSW 18 67634778 missense possibly damaging 0.85
R1508:Cep76 UTSW 18 67623288 missense probably damaging 1.00
R1511:Cep76 UTSW 18 67624958 missense probably benign
R4280:Cep76 UTSW 18 67640159 missense probably benign 0.39
R4355:Cep76 UTSW 18 67626640 missense probably benign 0.02
R4702:Cep76 UTSW 18 67634898 missense possibly damaging 0.48
R4847:Cep76 UTSW 18 67619569 missense probably benign 0.04
R5650:Cep76 UTSW 18 67625066 missense probably damaging 1.00
R5897:Cep76 UTSW 18 67638328 missense probably benign 0.00
R6648:Cep76 UTSW 18 67619734 missense probably benign 0.27
R7193:Cep76 UTSW 18 67641134 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGAAAGCCTACAGTGGCGTCTTCC -3'
(R):5'- CTGGCAGGTCAGTCATAGAAACAGG -3'

Sequencing Primer
(F):5'- AGTGGCGTCTTCCAGACAC -3'
(R):5'- actaccacttaactacatccttagc -3'
Posted On2013-05-23