Incidental Mutation 'R0450:Ppp1r3c'
ID39644
Institutional Source Beutler Lab
Gene Symbol Ppp1r3c
Ensembl Gene ENSMUSG00000067279
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 3C
Synonymsprotein targeting to glicogen, Ppp1r5, PTG
MMRRC Submission 038650-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0450 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location36731737-36736653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36734217 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 51 (F51Y)
Ref Sequence ENSEMBL: ENSMUSP00000084578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087321]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087321
AA Change: F51Y

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084578
Gene: ENSMUSG00000067279
AA Change: F51Y

DomainStartEndE-ValueType
low complexity region 115 128 N/A INTRINSIC
Pfam:CBM_21 151 257 5.5e-38 PFAM
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a carbohydrate binding protein that is a subunit of the protein phosphatase 1 (PP1) complex. PP1 catalyzes reversible protein phosphorylation, which is important in a wide range of cellular activities. The encoded protein affects glycogen biosynthesis by activating glycogen synthase and limiting glycogen breakdown by reducing glycogen phosphorylase activity. DNA hypermethylation of this gene has been found in colorectal cancer patients. The encoded protein also interacts with the laforin protein, which is a protein tyrosine phosphatase implicated in Lafora disease. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mice are embyronic lethal. Heterozygotes have reduced glycogen stores, attenuated glycogen synthesis, glucose intolerance, hyperinsulinemia and insulin resistance. Mice homozygous for a different knock-out allele exhibit normal lifespan with enhanced whole body insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl G A 2: 127,880,503 probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Arih2 T A 9: 108,605,092 H490L possibly damaging Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Cep76 A T 18: 67,634,780 N227K probably benign Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Glipr1l2 A G 10: 112,092,572 D124G probably benign Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hnrnph3 T A 10: 63,018,215 R41S probably benign Het
Hnrnph3 T A 10: 63,019,500 D2V probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mospd3 A G 5: 137,597,032 L233P probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Stk11 T C 10: 80,126,086 V47A probably damaging Het
Tmpo A C 10: 91,163,096 I276M probably benign Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Upb1 T C 10: 75,415,083 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Ppp1r3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Ppp1r3c APN 19 36734103 missense probably damaging 1.00
IGL00486:Ppp1r3c APN 19 36733924 missense probably damaging 1.00
IGL01865:Ppp1r3c APN 19 36734178 missense probably benign 0.00
IGL02896:Ppp1r3c APN 19 36733465 missense probably benign 0.26
R0110:Ppp1r3c UTSW 19 36734217 missense possibly damaging 0.66
R0456:Ppp1r3c UTSW 19 36733891 nonsense probably null
R0469:Ppp1r3c UTSW 19 36734217 missense possibly damaging 0.66
R1539:Ppp1r3c UTSW 19 36733961 missense probably benign
R1859:Ppp1r3c UTSW 19 36733611 missense probably damaging 1.00
R2228:Ppp1r3c UTSW 19 36733698 missense probably benign
R2229:Ppp1r3c UTSW 19 36733698 missense probably benign
R4534:Ppp1r3c UTSW 19 36734122 missense probably damaging 1.00
R4535:Ppp1r3c UTSW 19 36734122 missense probably damaging 1.00
R4619:Ppp1r3c UTSW 19 36734343 missense possibly damaging 0.94
R4630:Ppp1r3c UTSW 19 36733515 missense probably benign 0.02
R6015:Ppp1r3c UTSW 19 36733806 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGAAAGCGGTCCCGGAAAC -3'
(R):5'- TGTAGATCTCATCACCCCAGTGCTC -3'

Sequencing Primer
(F):5'- CTGGAGGAGATATCGTTAAGGTCC -3'
(R):5'- GCTCATTCACCACCTCTGAA -3'
Posted On2013-05-23