Incidental Mutation 'R5141:Sema6a'
ID396503
Institutional Source Beutler Lab
Gene Symbol Sema6a
Ensembl Gene ENSMUSG00000019647
Gene Namesema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A
Synonymssema, Sema6A-1, Semaq, A730020P05Rik, VIa
MMRRC Submission 042727-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5141 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location47235598-47368870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47248388 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1048 (T1048A)
Ref Sequence ENSEMBL: ENSMUSP00000120011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019791] [ENSMUST00000076043] [ENSMUST00000115449] [ENSMUST00000135790] [ENSMUST00000156422]
Predicted Effect probably damaging
Transcript: ENSMUST00000019791
AA Change: T1031A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019791
Gene: ENSMUSG00000019647
AA Change: T1031A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 648 670 N/A INTRINSIC
low complexity region 932 951 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076043
AA Change: T976A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075420
Gene: ENSMUSG00000019647
AA Change: T976A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 593 615 N/A INTRINSIC
low complexity region 877 896 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115449
AA Change: T1005A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111109
Gene: ENSMUSG00000019647
AA Change: T1005A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 461 1.24e-168 SMART
PSI 488 543 9.57e-1 SMART
transmembrane domain 622 644 N/A INTRINSIC
low complexity region 906 925 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123228
SMART Domains Protein: ENSMUSP00000120249
Gene: ENSMUSG00000019647

DomainStartEndE-ValueType
Blast:PSI 2 45 4e-26 BLAST
PDB:3OKY|B 2 47 2e-26 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000135790
AA Change: T1048A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120011
Gene: ENSMUSG00000019647
AA Change: T1048A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156422
AA Change: T1031A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121442
Gene: ENSMUSG00000019647
AA Change: T1031A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 648 670 N/A INTRINSIC
low complexity region 932 951 N/A INTRINSIC
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transmembrane semaphorin SEMA6A is expressed in developing neural tissue and is required for proper development of the thalamocortical projection (Leighton et al., 2001 [PubMed 11242070]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit defects in lamina-specific neurite stratification of specific retinal neuron subtypes and disruption of the dendritic plexus organization of On but not Off starburst amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,573,128 V193A probably benign Het
Adamts18 T A 8: 113,775,270 T320S probably damaging Het
Adamtsl1 G T 4: 86,156,850 M151I possibly damaging Het
Adgrv1 A T 13: 81,270,918 V5986E probably damaging Het
Aifm3 A G 16: 17,499,722 E69G probably damaging Het
Akap13 C A 7: 75,609,614 T662K probably benign Het
Alms1 A G 6: 85,621,432 D1080G probably benign Het
Als2 T C 1: 59,170,452 E1457G possibly damaging Het
Apobec4 A G 1: 152,756,213 probably benign Het
Apoo-ps C T 13: 107,414,395 noncoding transcript Het
Aspscr1 G A 11: 120,689,177 V181I probably benign Het
Atrn T C 2: 130,999,130 probably benign Het
C3 T A 17: 57,219,570 I804F probably damaging Het
Cbfa2t3 C T 8: 122,635,021 G421R probably benign Het
Chmp4c A G 3: 10,367,153 E41G probably damaging Het
Clk4 T A 11: 51,275,771 F96L possibly damaging Het
Ctsg G A 14: 56,101,727 R25* probably null Het
Cul1 A G 6: 47,520,839 D618G probably benign Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dip2a G A 10: 76,270,453 T1326I probably damaging Het
Etnk2 A G 1: 133,368,862 I210V probably benign Het
Gm5773 T A 3: 93,773,727 D235E probably benign Het
Gm7353 T C 7: 3,111,001 noncoding transcript Het
Gpi1 G A 7: 34,227,096 probably benign Het
Ing4 T C 6: 125,039,874 M5T probably benign Het
Inpp4a A G 1: 37,380,087 I583V probably benign Het
Isyna1 T C 8: 70,594,893 V64A probably damaging Het
Katnal2 T A 18: 76,997,641 D310V probably damaging Het
Kbtbd8 A G 6: 95,121,839 T126A probably damaging Het
Kif13a T C 13: 46,752,721 D582G probably benign Het
Lmf2 G A 15: 89,351,607 probably null Het
Lrp2 T C 2: 69,552,349 probably null Het
Lrp4 T C 2: 91,478,678 probably benign Het
Lyzl1 A C 18: 4,169,209 D71A possibly damaging Het
Mak C T 13: 41,032,563 C543Y possibly damaging Het
Mapk8ip1 T C 2: 92,386,765 D404G probably damaging Het
Mdga1 C T 17: 29,852,493 E385K probably benign Het
Mst1r T A 9: 107,912,241 I573N probably damaging Het
Muc5ac T A 7: 141,814,742 N2365K possibly damaging Het
Ncan T C 8: 70,112,837 E179G probably damaging Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1228 A C 2: 89,249,129 Y176* probably null Het
Olfr44 A G 9: 39,484,531 F238L probably damaging Het
Olfr975 T G 9: 39,949,874 K299T probably benign Het
Pcolce G T 5: 137,605,750 Q352K probably benign Het
Peg3 G T 7: 6,709,382 T947N probably benign Het
Pld3 C T 7: 27,533,795 D344N probably damaging Het
Plec A C 15: 76,190,533 D411E probably damaging Het
Pmp2 C T 3: 10,182,414 D72N probably benign Het
Ptpn9 T C 9: 57,036,676 V278A possibly damaging Het
Rbm33 A G 5: 28,352,689 H300R probably damaging Het
Rpgrip1l T C 8: 91,260,918 Q837R probably benign Het
Rwdd4a T C 8: 47,550,674 probably benign Het
Senp1 G A 15: 98,076,607 A108V probably benign Het
Serpine2 G T 1: 79,802,863 Q290K possibly damaging Het
Sesn1 A G 10: 41,811,101 N27S probably benign Het
Shroom1 T A 11: 53,463,982 L243* probably null Het
Slc17a5 A G 9: 78,540,988 Y395H probably damaging Het
Slc5a8 T C 10: 88,919,560 probably null Het
Sptbn5 G A 2: 120,061,731 S1083F probably benign Het
Stx4a T A 7: 127,846,615 V231E probably damaging Het
Swt1 A T 1: 151,411,394 S116T probably benign Het
Syt9 C T 7: 107,504,219 T408I probably damaging Het
Tgm7 T C 2: 121,100,999 T228A probably benign Het
Tmem115 A G 9: 107,537,942 D310G probably benign Het
Trcg1 G A 9: 57,241,304 G53D probably damaging Het
Tsfm T C 10: 127,029,613 K100E probably damaging Het
Usp1 A G 4: 98,934,209 T587A probably damaging Het
Vcpip1 G T 1: 9,748,077 A27E unknown Het
Vmn2r49 T C 7: 9,986,373 N397S probably benign Het
Vmn2r8 A G 5: 108,808,706 S17P probably damaging Het
Vwa3b A G 1: 37,187,021 probably benign Het
Ythdc2 T A 18: 44,865,047 S1094T probably benign Het
Zbtb22 C G 17: 33,918,636 S585C possibly damaging Het
Zhx2 A G 15: 57,821,786 T184A probably benign Het
Other mutations in Sema6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Sema6a APN 18 47289975 critical splice donor site probably null
IGL01351:Sema6a APN 18 47281302 missense possibly damaging 0.84
IGL01594:Sema6a APN 18 47248817 missense probably damaging 1.00
IGL01953:Sema6a APN 18 47290120 nonsense probably null
IGL02077:Sema6a APN 18 47283398 missense possibly damaging 0.94
IGL02632:Sema6a APN 18 47290155 missense probably damaging 1.00
IGL02957:Sema6a APN 18 47249224 missense probably damaging 1.00
IGL03013:Sema6a APN 18 47248394 missense probably benign 0.01
IGL03279:Sema6a APN 18 47300090 nonsense probably null
saphire UTSW 18 47306429 nonsense probably null
IGL02988:Sema6a UTSW 18 47298214 missense probably damaging 1.00
R0114:Sema6a UTSW 18 47290177 missense probably damaging 1.00
R0311:Sema6a UTSW 18 47290045 unclassified probably null
R0312:Sema6a UTSW 18 47290045 unclassified probably null
R0347:Sema6a UTSW 18 47291129 missense probably damaging 1.00
R0350:Sema6a UTSW 18 47270718 missense probably benign
R0366:Sema6a UTSW 18 47290045 unclassified probably null
R0368:Sema6a UTSW 18 47290045 unclassified probably null
R0391:Sema6a UTSW 18 47290045 unclassified probably null
R0403:Sema6a UTSW 18 47290045 unclassified probably null
R0466:Sema6a UTSW 18 47290045 unclassified probably null
R0515:Sema6a UTSW 18 47290045 unclassified probably null
R0517:Sema6a UTSW 18 47290045 unclassified probably null
R0542:Sema6a UTSW 18 47248576 missense probably damaging 1.00
R0557:Sema6a UTSW 18 47249500 missense probably benign 0.01
R0569:Sema6a UTSW 18 47270805 splice site probably null
R0650:Sema6a UTSW 18 47290045 unclassified probably null
R0689:Sema6a UTSW 18 47290045 unclassified probably null
R0694:Sema6a UTSW 18 47290045 unclassified probably null
R0726:Sema6a UTSW 18 47291981 missense probably damaging 1.00
R0741:Sema6a UTSW 18 47290045 unclassified probably null
R0821:Sema6a UTSW 18 47290045 unclassified probably null
R0824:Sema6a UTSW 18 47290045 unclassified probably null
R0924:Sema6a UTSW 18 47248492 missense probably damaging 1.00
R1108:Sema6a UTSW 18 47306431 missense probably benign 0.02
R1255:Sema6a UTSW 18 47249299 missense probably damaging 0.98
R1422:Sema6a UTSW 18 47306431 missense probably benign 0.02
R1531:Sema6a UTSW 18 47248999 missense probably damaging 1.00
R1707:Sema6a UTSW 18 47283445 missense probably benign 0.04
R1746:Sema6a UTSW 18 47306349 splice site probably benign
R1807:Sema6a UTSW 18 47276424 missense possibly damaging 0.85
R1974:Sema6a UTSW 18 47270629 missense probably benign 0.04
R1987:Sema6a UTSW 18 47300142 missense probably damaging 1.00
R2044:Sema6a UTSW 18 47306429 nonsense probably null
R3719:Sema6a UTSW 18 47249077 missense probably damaging 1.00
R4491:Sema6a UTSW 18 47306457 utr 5 prime probably benign
R4552:Sema6a UTSW 18 47291923 missense probably damaging 1.00
R4707:Sema6a UTSW 18 47248712 missense probably benign 0.43
R4710:Sema6a UTSW 18 47270683 missense probably benign 0.00
R4713:Sema6a UTSW 18 47249296 missense possibly damaging 0.79
R4963:Sema6a UTSW 18 47298251 missense possibly damaging 0.48
R5088:Sema6a UTSW 18 47249129 missense probably damaging 1.00
R5133:Sema6a UTSW 18 47300128 missense probably damaging 1.00
R5135:Sema6a UTSW 18 47291172 missense probably damaging 1.00
R5277:Sema6a UTSW 18 47276544 intron probably benign
R5551:Sema6a UTSW 18 47248528 missense possibly damaging 0.76
R5618:Sema6a UTSW 18 47281948 missense probably damaging 0.98
R5717:Sema6a UTSW 18 47249263 missense probably benign 0.01
R5729:Sema6a UTSW 18 47281343 missense probably damaging 1.00
R5779:Sema6a UTSW 18 47248826 missense probably damaging 1.00
R5917:Sema6a UTSW 18 47281338 missense probably benign 0.05
R6054:Sema6a UTSW 18 47283403 missense possibly damaging 0.94
R6142:Sema6a UTSW 18 47281199 missense probably benign 0.00
R6209:Sema6a UTSW 18 47298302 splice site probably null
R6307:Sema6a UTSW 18 47249164 missense probably damaging 1.00
R6734:Sema6a UTSW 18 47279169 missense probably benign 0.31
X0065:Sema6a UTSW 18 47283319 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CGGCCCAATTTTGAAGAGTATCC -3'
(R):5'- TCCAGGAACCAGAGCTTTGG -3'

Sequencing Primer
(F):5'- TGAAGAGTATCCCTATGTCCCAGG -3'
(R):5'- GACTCTATCCAGGTGCACAG -3'
Posted On2016-06-21