Incidental Mutation 'R5143:Gm17689'
ID396528
Institutional Source Beutler Lab
Gene Symbol Gm17689
Ensembl Gene ENSMUSG00000091248
Gene Namepredicted gene, 17689
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5143 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location36581278-36582635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36581904 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 41 (N41Y)
Ref Sequence ENSEMBL: ENSMUSP00000126891 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000170030
AA Change: N41Y

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
Adrb2 T C 18: 62,178,776 Y326C probably damaging Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
AY358078 T C 14: 51,802,549 S39P unknown Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Caap1 A T 4: 94,501,382 N238K probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Chrna7 T C 7: 63,106,147 Y217C probably damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Cyp2a12 A G 7: 27,036,611 I482V probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Fut8 A G 12: 77,365,209 D111G probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Hoxd3 C T 2: 74,746,372 R39C probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Olfr690 T A 7: 105,329,524 I223F probably damaging Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Plppr5 A G 3: 117,625,903 T207A probably benign Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Prmt8 A G 6: 127,732,714 M61T probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tmc2 A T 2: 130,234,818 S355C probably damaging Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttc14 T C 3: 33,808,901 probably benign Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Usp17lb A T 7: 104,841,478 S80T probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Zbtb42 T C 12: 112,679,514 V41A probably damaging Het
Other mutations in Gm17689
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Gm17689 APN 9 36581363 missense probably benign 0.00
IGL01693:Gm17689 APN 9 36581366 missense probably benign 0.31
IGL02268:Gm17689 APN 9 36581870 missense possibly damaging 0.71
IGL03191:Gm17689 APN 9 36581402 missense probably benign 0.00
PIT4354001:Gm17689 UTSW 9 36581301 missense possibly damaging 0.71
R0401:Gm17689 UTSW 9 36582628 missense unknown
R0743:Gm17689 UTSW 9 36581301 missense probably benign 0.03
R1483:Gm17689 UTSW 9 36581324 missense probably benign 0.00
R1701:Gm17689 UTSW 9 36581818 critical splice donor site probably benign
R2258:Gm17689 UTSW 9 36581865 missense probably benign 0.03
R3764:Gm17689 UTSW 9 36581818 critical splice donor site probably null
R6783:Gm17689 UTSW 9 36581335 synonymous probably null
R7013:Gm17689 UTSW 9 36582558 missense unknown
R7014:Gm17689 UTSW 9 36582558 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAGCCAATACCAGGGGAAG -3'
(R):5'- CTCTTTCCAGAGGCCTGCTG -3'

Sequencing Primer
(F):5'- TACCAGGGGAAGGGAGCCC -3'
(R):5'- TGGGGTCAGCAAAACATACAAC -3'
Posted On2016-06-21