Incidental Mutation 'R5154:Cit'
ID396572
Institutional Source Beutler Lab
Gene Symbol Cit
Ensembl Gene ENSMUSG00000029516
Gene Namecitron
SynonymsCRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase
MMRRC Submission 042736-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R5154 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location115845278-116008947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115988405 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1590 (L1590P)
Ref Sequence ENSEMBL: ENSMUSP00000115802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]
Predicted Effect probably damaging
Transcript: ENSMUST00000051704
AA Change: L1632P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: L1632P

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 891 905 N/A INTRINSIC
low complexity region 915 948 N/A INTRINSIC
low complexity region 950 968 N/A INTRINSIC
low complexity region 1068 1081 N/A INTRINSIC
low complexity region 1138 1156 N/A INTRINSIC
low complexity region 1182 1203 N/A INTRINSIC
internal_repeat_1 1243 1282 1.05e-5 PROSPERO
low complexity region 1353 1364 N/A INTRINSIC
C1 1389 1437 1.97e-9 SMART
PH 1470 1591 1.31e-8 SMART
CNH 1618 1915 1.78e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102560
AA Change: L1647P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: L1647P

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1244 N/A INTRINSIC
coiled coil region 1297 1338 N/A INTRINSIC
low complexity region 1368 1379 N/A INTRINSIC
C1 1404 1452 1.97e-9 SMART
PH 1485 1606 1.31e-8 SMART
CNH 1633 1930 1.78e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112008
AA Change: L1605P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: L1605P

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1202 N/A INTRINSIC
coiled coil region 1255 1296 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
C1 1362 1410 1.97e-9 SMART
PH 1443 1564 1.31e-8 SMART
CNH 1591 1888 1.78e-112 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122877
Predicted Effect probably benign
Transcript: ENSMUST00000123736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134609
Predicted Effect probably damaging
Transcript: ENSMUST00000141101
AA Change: L1590P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: L1590P

DomainStartEndE-ValueType
S_TKc 97 359 1.4e-91 SMART
S_TK_X 360 422 3e-18 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 686 698 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 873 906 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1096 1114 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
internal_repeat_1 1201 1240 1.73e-5 PROSPERO
low complexity region 1311 1322 N/A INTRINSIC
C1 1347 1395 9.7e-12 SMART
PH 1428 1549 6e-11 SMART
CNH 1576 1873 8.6e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147479
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A C 4: 39,450,938 H48P probably damaging Het
Angptl7 C T 4: 148,497,425 R168H probably damaging Het
Ankrd11 A C 8: 122,893,139 F1325V probably damaging Het
Ankrd13c A G 3: 157,988,660 D266G possibly damaging Het
Apold1 A T 6: 134,983,673 H30L possibly damaging Het
Arel1 A G 12: 84,931,773 F362L probably benign Het
Arhgef4 T A 1: 34,732,374 M1254K probably benign Het
Arid2 T A 15: 96,401,985 V1793E probably damaging Het
Bcl7a T C 5: 123,369,359 S156P probably damaging Het
Cbr3 A G 16: 93,685,139 I128V probably benign Het
Cct6b G A 11: 82,739,695 P299L probably damaging Het
Cd180 A T 13: 102,705,774 N443Y probably damaging Het
Cd80 A G 16: 38,473,980 K75R probably benign Het
Cdk1 A T 10: 69,340,468 probably benign Het
Cep192 T A 18: 67,850,684 F1565I probably damaging Het
Chtf18 T C 17: 25,723,720 T412A probably damaging Het
Clcn2 T A 16: 20,703,303 R845S probably benign Het
Cndp2 C T 18: 84,668,602 V432I probably benign Het
Cnnm2 A T 19: 46,763,132 R454W probably benign Het
Cpne8 T G 15: 90,499,918 I480L probably benign Het
Cr2 A G 1: 195,159,446 W400R probably damaging Het
Cul5 A G 9: 53,625,867 L528P probably damaging Het
Dlgap5 C T 14: 47,413,720 V119M probably damaging Het
Dnah12 T C 14: 26,849,363 S190P probably benign Het
Dnah3 T A 7: 119,952,419 K2881N probably damaging Het
Dnmt3a A T 12: 3,896,008 I288F probably damaging Het
Dse T A 10: 34,153,661 T478S possibly damaging Het
Edn1 C T 13: 42,305,023 T104I probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eprs A G 1: 185,413,465 H1157R probably damaging Het
Fam168b G A 1: 34,818,099 T179I possibly damaging Het
Fzd5 A G 1: 64,735,972 V210A probably benign Het
Gm9742 T C 13: 8,035,045 noncoding transcript Het
Gpc1 G A 1: 92,857,029 G308D probably damaging Het
Gpr141 C T 13: 19,752,242 R121K probably benign Het
Greb1l A G 18: 10,458,312 T30A probably benign Het
Grk3 A T 5: 112,941,717 I281N probably damaging Het
Hnrnpdl A T 5: 100,036,512 Y289* probably null Het
Hsf2 T G 10: 57,504,712 V214G probably benign Het
Igf2bp1 G A 11: 95,963,547 Q563* probably null Het
Il31ra T A 13: 112,523,997 D605V possibly damaging Het
Insm2 G A 12: 55,600,197 C242Y probably damaging Het
Ints3 C T 3: 90,415,561 V121I probably benign Het
Kcnt2 A T 1: 140,351,256 L48F possibly damaging Het
Kit G A 5: 75,640,540 V529M probably damaging Het
Mark2 G A 19: 7,283,074 P13S probably damaging Het
Mthfsd A G 8: 121,098,740 V364A probably damaging Het
Mtmr11 C G 3: 96,164,319 S185R probably benign Het
Myot A G 18: 44,354,214 I373V probably benign Het
N4bp3 A T 11: 51,645,312 V231D probably benign Het
Olfr1089 A T 2: 86,732,777 Y278* probably null Het
Olfr1102 T C 2: 87,002,038 V23A probably benign Het
Pdcd6ip A G 9: 113,691,542 F125L probably damaging Het
Prpf39 A T 12: 65,048,277 Q124L probably benign Het
Reln A T 5: 21,988,765 N1398K probably damaging Het
Rhod A T 19: 4,432,094 D97E probably damaging Het
Rxra T C 2: 27,757,868 probably null Het
Slc1a3 T C 15: 8,642,949 I349V probably benign Het
Slc37a2 A T 9: 37,231,643 *502R probably null Het
Slc9b1 T C 3: 135,373,179 I199T probably damaging Het
Spg20 C T 3: 55,117,329 P115L probably damaging Het
Tnpo1 A T 13: 98,870,305 C205S possibly damaging Het
Tubb1 T A 2: 174,456,864 I113N probably benign Het
Tyrp1 G A 4: 80,850,717 V483I probably benign Het
Vwde T C 6: 13,215,758 S100G probably benign Het
Zfhx3 A T 8: 108,800,575 I1035F probably damaging Het
Zfp618 G T 4: 63,133,209 K742N probably damaging Het
Zfp873 T C 10: 82,060,191 V252A possibly damaging Het
Other mutations in Cit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Cit APN 5 115846465 missense probably damaging 0.99
IGL00482:Cit APN 5 115938755 missense probably damaging 0.97
IGL01317:Cit APN 5 115908716 missense probably benign 0.03
IGL01335:Cit APN 5 115908830 splice site probably benign
IGL01415:Cit APN 5 115941903 missense possibly damaging 0.78
IGL01447:Cit APN 5 115873843 splice site probably benign
IGL01537:Cit APN 5 115933854 missense probably benign 0.00
IGL01621:Cit APN 5 115992603 splice site probably benign
IGL02010:Cit APN 5 115875947 missense probably damaging 1.00
IGL02538:Cit APN 5 115986989 nonsense probably null
IGL02607:Cit APN 5 115859209 missense probably benign
IGL02720:Cit APN 5 115995452 missense probably benign 0.26
IGL02725:Cit APN 5 115985473 missense probably benign 0.02
IGL02967:Cit APN 5 115945837 missense probably benign 0.11
IGL02973:Cit APN 5 116005999 missense possibly damaging 0.73
IGL03383:Cit APN 5 115873845 splice site probably benign
PIT4514001:Cit UTSW 5 115997854 critical splice donor site probably null
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0226:Cit UTSW 5 115984840 missense probably damaging 0.99
R0320:Cit UTSW 5 115979445 missense possibly damaging 0.87
R0401:Cit UTSW 5 115985479 missense probably benign 0.06
R0480:Cit UTSW 5 115933393 splice site probably benign
R0609:Cit UTSW 5 115873943 missense probably damaging 0.98
R0737:Cit UTSW 5 115946919 missense probably damaging 1.00
R1238:Cit UTSW 5 115851221 missense probably benign 0.30
R1503:Cit UTSW 5 115873900 missense possibly damaging 0.94
R1551:Cit UTSW 5 115945842 missense probably benign 0.00
R1602:Cit UTSW 5 115997730 missense probably damaging 1.00
R1720:Cit UTSW 5 115967897 missense probably damaging 0.98
R1854:Cit UTSW 5 115873901 missense probably damaging 1.00
R1886:Cit UTSW 5 115933486 missense probably damaging 1.00
R2024:Cit UTSW 5 115947924 missense probably damaging 0.97
R2024:Cit UTSW 5 116005840 missense probably damaging 0.97
R2048:Cit UTSW 5 115886813 splice site probably null
R2128:Cit UTSW 5 115985507 missense possibly damaging 0.63
R2192:Cit UTSW 5 115968009 missense probably benign 0.00
R2244:Cit UTSW 5 115926505 missense probably damaging 1.00
R2518:Cit UTSW 5 115987046 missense probably damaging 0.99
R2679:Cit UTSW 5 115969115 missense probably benign 0.00
R2898:Cit UTSW 5 115873978 unclassified probably null
R2908:Cit UTSW 5 115981676 missense probably benign 0.00
R3079:Cit UTSW 5 115925486 missense probably damaging 0.97
R3779:Cit UTSW 5 115859341 missense probably benign 0.01
R4081:Cit UTSW 5 115948050 missense probably damaging 1.00
R4494:Cit UTSW 5 115873984 missense probably damaging 1.00
R4610:Cit UTSW 5 115994087 missense probably benign 0.01
R4757:Cit UTSW 5 115997549 missense probably damaging 1.00
R4788:Cit UTSW 5 115933506 missense probably damaging 1.00
R4816:Cit UTSW 5 115908691 missense probably damaging 1.00
R4890:Cit UTSW 5 115988123 intron probably benign
R4899:Cit UTSW 5 115863028 missense possibly damaging 0.60
R4928:Cit UTSW 5 115985797 missense probably benign 0.00
R5073:Cit UTSW 5 115946843 missense probably benign 0.24
R5151:Cit UTSW 5 115979835 missense probably damaging 1.00
R5222:Cit UTSW 5 115952543 missense probably benign 0.03
R5814:Cit UTSW 5 115979419 missense probably damaging 1.00
R5935:Cit UTSW 5 115925539 intron probably benign
R5946:Cit UTSW 5 115997534 missense probably damaging 1.00
R6051:Cit UTSW 5 115846405 missense probably benign
R6289:Cit UTSW 5 116006326 makesense probably null
R6298:Cit UTSW 5 115948065 missense probably damaging 1.00
R6362:Cit UTSW 5 115886676 missense probably benign 0.01
R6545:Cit UTSW 5 115846434 missense probably null 0.00
R6761:Cit UTSW 5 115908675 missense probably damaging 1.00
R6798:Cit UTSW 5 115926526 missense possibly damaging 0.56
R6814:Cit UTSW 5 115884963 missense probably damaging 1.00
R6825:Cit UTSW 5 115981774 missense probably damaging 0.99
R6845:Cit UTSW 5 115984888 missense probably damaging 1.00
R6983:Cit UTSW 5 115994091 missense probably damaging 1.00
R7164:Cit UTSW 5 115985787 missense possibly damaging 0.94
Z1088:Cit UTSW 5 115985533 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ATGACCGGCTTGACATGAAC -3'
(R):5'- TTCTGTGCATCTCCAGTGCG -3'

Sequencing Primer
(F):5'- GGCTTGACATGAACTGCAC -3'
(R):5'- ATCTCCAGTGCGACACTCG -3'
Posted On2016-06-21