Incidental Mutation 'R5155:Ankrd44'
ID396627
Institutional Source Beutler Lab
Gene Symbol Ankrd44
Ensembl Gene ENSMUSG00000052331
Gene Nameankyrin repeat domain 44
SynonymsE130014H08Rik
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location54645340-54926387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54778330 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 73 (M73K)
Ref Sequence ENSEMBL: ENSMUSP00000137616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044359] [ENSMUST00000177679] [ENSMUST00000179030]
Predicted Effect probably benign
Transcript: ENSMUST00000044359
AA Change: M73K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040327
Gene: ENSMUSG00000052331
AA Change: M73K

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 5.98e1 SMART
ANK 422 451 7.13e-6 SMART
ANK 455 484 1.18e-6 SMART
ANK 488 545 1.17e2 SMART
ANK 549 579 3.31e-1 SMART
ANK 584 613 3.91e-3 SMART
ANK 617 646 1.43e-5 SMART
ANK 651 680 2.73e-2 SMART
ANK 687 716 5.41e-6 SMART
ANK 720 749 5.53e-3 SMART
ANK 753 785 1.52e0 SMART
ANK 789 819 9.27e-5 SMART
ANK 821 851 1.52e0 SMART
ANK 856 885 6.02e-4 SMART
ANK 889 919 3.08e-1 SMART
ANK 923 955 3.36e-2 SMART
ANK 959 988 6.26e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177679
AA Change: M48K

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000137216
Gene: ENSMUSG00000052331
AA Change: M48K

DomainStartEndE-ValueType
ANK 15 44 3.23e-4 SMART
ANK 48 77 1.12e-3 SMART
ANK 81 110 1.65e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178935
Predicted Effect probably benign
Transcript: ENSMUST00000179030
AA Change: M73K

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137616
Gene: ENSMUSG00000052331
AA Change: M73K

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 3.26e0 SMART
ANK 404 433 7.13e-6 SMART
ANK 437 466 1.18e-6 SMART
ANK 470 527 1.17e2 SMART
ANK 531 561 3.31e-1 SMART
ANK 566 595 3.91e-3 SMART
ANK 599 628 1.43e-5 SMART
ANK 633 662 2.73e-2 SMART
ANK 669 698 5.41e-6 SMART
ANK 702 731 5.53e-3 SMART
ANK 735 767 1.52e0 SMART
ANK 771 801 9.27e-5 SMART
ANK 803 833 1.52e0 SMART
ANK 838 867 6.02e-4 SMART
ANK 871 901 3.08e-1 SMART
ANK 905 937 3.36e-2 SMART
ANK 941 970 6.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180327
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Pum2 T C 12: 8,713,572 V243A possibly damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Ankrd44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ankrd44 APN 1 54662647 splice site probably benign
IGL00839:Ankrd44 APN 1 54667435 missense probably benign 0.27
IGL01145:Ankrd44 APN 1 54762259 critical splice donor site probably null
IGL01380:Ankrd44 APN 1 54727565 missense probably benign 0.00
IGL01415:Ankrd44 APN 1 54752928 missense probably damaging 1.00
IGL01958:Ankrd44 APN 1 54766966 missense probably damaging 0.99
IGL02014:Ankrd44 APN 1 54657620 missense possibly damaging 0.95
IGL02745:Ankrd44 APN 1 54766791 missense probably damaging 1.00
IGL03008:Ankrd44 APN 1 54766809 missense probably damaging 1.00
wilderness UTSW 1 54735034 synonymous silent
PIT4812001:Ankrd44 UTSW 1 54723038 nonsense probably null
R0416:Ankrd44 UTSW 1 54743339 missense possibly damaging 0.63
R0554:Ankrd44 UTSW 1 54763758 missense probably benign 0.00
R0575:Ankrd44 UTSW 1 54762310 missense probably damaging 1.00
R1323:Ankrd44 UTSW 1 54766450 splice site probably benign
R1605:Ankrd44 UTSW 1 54828622 missense probably benign 0.36
R2032:Ankrd44 UTSW 1 54723009 splice site probably null
R4458:Ankrd44 UTSW 1 54762391 missense possibly damaging 0.92
R4610:Ankrd44 UTSW 1 54766748 intron probably benign
R4727:Ankrd44 UTSW 1 54667417 missense probably benign 0.05
R4780:Ankrd44 UTSW 1 54763757 missense probably benign 0.00
R4801:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4802:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4810:Ankrd44 UTSW 1 54735143 intron probably benign
R4961:Ankrd44 UTSW 1 54663912 missense probably damaging 1.00
R5053:Ankrd44 UTSW 1 54735089 nonsense probably null
R5093:Ankrd44 UTSW 1 54763718 missense probably damaging 1.00
R5248:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
R5306:Ankrd44 UTSW 1 54926203 utr 5 prime probably benign
R5595:Ankrd44 UTSW 1 54735050 missense probably damaging 1.00
R5595:Ankrd44 UTSW 1 54762347 missense probably damaging 1.00
R6288:Ankrd44 UTSW 1 54763763 missense probably damaging 1.00
R6332:Ankrd44 UTSW 1 54762273 missense probably damaging 1.00
R6453:Ankrd44 UTSW 1 54657704 splice site probably null
R6610:Ankrd44 UTSW 1 54655087 missense probably benign 0.02
R6699:Ankrd44 UTSW 1 54762445 missense probably damaging 1.00
R6905:Ankrd44 UTSW 1 54792494 missense probably damaging 1.00
R7173:Ankrd44 UTSW 1 54766391 missense probably damaging 1.00
R7178:Ankrd44 UTSW 1 54649440 missense
R7219:Ankrd44 UTSW 1 54766910 missense probably damaging 1.00
R7276:Ankrd44 UTSW 1 54735080 missense probably benign 0.05
R7283:Ankrd44 UTSW 1 54729796 missense probably damaging 1.00
R7414:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
Z1088:Ankrd44 UTSW 1 54658982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGACCCCGTACTATGCTC -3'
(R):5'- CAAGATAGATTTCTGTTGGCCC -3'

Sequencing Primer
(F):5'- GGAACCTCCACCTAACTTTGG -3'
(R):5'- GGCCCCTTTATCCCATATAAAATC -3'
Posted On2016-06-21