Incidental Mutation 'R0452:Tdrd7'
ID39663
Institutional Source Beutler Lab
Gene Symbol Tdrd7
Ensembl Gene ENSMUSG00000035517
Gene Nametudor domain containing 7
Synonyms5730495N10Rik
MMRRC Submission 038652-MU
Accession Numbers

Genbank: NM_146142; MGI: 2140279

Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock #R0452 (G1)
Quality Score207
Status Validated
Chromosome4
Chromosomal Location45965334-46034761 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 45965488 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107777]
Predicted Effect probably benign
Transcript: ENSMUST00000107777
SMART Domains Protein: ENSMUSP00000103406
Gene: ENSMUSG00000035517

DomainStartEndE-ValueType
Pfam:OST-HTH 36 106 5.7e-11 PFAM
internal_repeat_1 256 333 3.1e-9 PROSPERO
low complexity region 335 351 N/A INTRINSIC
internal_repeat_1 359 433 3.1e-9 PROSPERO
TUDOR 533 589 2.08e-5 SMART
TUDOR 723 779 1.66e-4 SMART
TUDOR 978 1034 4.03e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Tudor family of proteins. This protein contains conserved Tudor domains and LOTUS domains. It is a component of RNA granules, which function in RNA processing. Mutations in this gene have been associated with cataract formation in mouse and human. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene causes arrest of spermatogenesis, male sterility, glaucoma, and cataracts. Aging mice homozygous for an ENU-induced (null) allele show additional ocular phenotypes including an enlarged anterior chamber, lens extrusion, a flat iris, uveitis, and optic neuropathy. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030452D12Rik A G 8: 106,507,190 probably benign Het
Acap3 C A 4: 155,902,328 S347* probably null Het
Acvr1 G A 2: 58,500,495 P19L probably benign Het
Add2 G T 6: 86,104,629 E366* probably null Het
Ankrd28 C A 14: 31,748,738 A153S probably damaging Het
Anxa8 A T 14: 34,094,770 I206F probably damaging Het
Arhgef4 G A 1: 34,732,322 E1237K probably damaging Het
Arid1a C T 4: 133,689,105 A1120T unknown Het
Atad5 T C 11: 80,106,421 V857A probably damaging Het
Atp2a3 T A 11: 72,977,232 probably null Het
Atxn1l C T 8: 109,732,395 V412I possibly damaging Het
Card11 A G 5: 140,880,370 S923P probably benign Het
Cars C A 7: 143,592,625 E21* probably null Het
Ccdc115 A G 1: 34,437,621 probably benign Het
Ccnj T A 19: 40,845,064 probably null Het
Cds2 C T 2: 132,298,479 T182I probably damaging Het
Ceacam14 A G 7: 17,815,323 H213R probably benign Het
Cfap44 A T 16: 44,431,945 M806L probably benign Het
Chd8 A T 14: 52,214,587 I1317K probably damaging Het
Cherp A T 8: 72,461,522 probably benign Het
Creb5 C G 6: 53,604,542 T30S possibly damaging Het
Csf2ra A G 19: 61,226,895 M94T probably benign Het
Cyp2b19 A C 7: 26,766,762 D330A probably benign Het
Ddost G A 4: 138,310,188 V188M possibly damaging Het
Dnah7a A T 1: 53,605,819 D1019E probably benign Het
Dtx1 A T 5: 120,694,992 I127N possibly damaging Het
Dyrk2 T C 10: 118,868,763 T3A possibly damaging Het
Elovl5 C T 9: 77,960,911 T35M probably damaging Het
Emc7 T C 2: 112,466,969 probably benign Het
Erp27 T C 6: 136,909,489 Y182C probably damaging Het
Exoc2 T A 13: 30,886,327 probably benign Het
F5 A C 1: 164,185,107 D530A probably damaging Het
Fam149a A T 8: 45,355,649 V149E probably damaging Het
Fbxo41 A G 6: 85,478,182 S614P probably damaging Het
Fmn1 T A 2: 113,636,779 Y1342N possibly damaging Het
Gm10334 A G 6: 41,445,337 Y45H probably benign Het
Gpr22 T A 12: 31,708,794 D443V possibly damaging Het
Il17rd T A 14: 27,091,931 W56R probably damaging Het
Itga2b A T 11: 102,465,953 probably null Het
Jmjd1c T C 10: 67,255,482 M2514T probably benign Het
Klk9 T C 7: 43,794,251 probably benign Het
Krr1 T C 10: 111,975,598 Y66H probably damaging Het
Lamb2 T C 9: 108,486,354 probably benign Het
Lgals3bp A T 11: 118,393,464 Y430N probably benign Het
Lrp10 T C 14: 54,467,579 V113A probably benign Het
Mgam A G 6: 40,759,090 Y841C probably damaging Het
Nisch T A 14: 31,177,464 probably benign Het
Nlrp4d G A 7: 10,378,292 T650I probably benign Het
Olfr1314 T A 2: 112,092,636 K22* probably null Het
Olfr506 C T 7: 108,612,370 T21I possibly damaging Het
Parp4 A G 14: 56,648,843 D1793G unknown Het
Pcm1 A G 8: 41,325,905 D1850G probably benign Het
Pgap2 G A 7: 102,236,462 A145T probably damaging Het
Phc1 G A 6: 122,323,036 A583V probably damaging Het
Plcd3 G A 11: 103,071,259 probably benign Het
Ppm1m T A 9: 106,197,302 Q214L probably damaging Het
Prkg2 A G 5: 98,997,520 probably benign Het
Rasal3 T C 17: 32,395,817 probably benign Het
Rfc1 A T 5: 65,264,297 D1086E probably benign Het
Rnf145 T A 11: 44,561,760 L522H probably damaging Het
Setd2 T A 9: 110,553,100 probably null Het
Sik1 C A 17: 31,849,081 V377F possibly damaging Het
Slc44a4 T C 17: 34,928,095 I367T possibly damaging Het
Slfn3 A G 11: 83,213,128 D275G possibly damaging Het
Smarcad1 A T 6: 65,074,822 N313I possibly damaging Het
Smc4 A T 3: 69,008,028 K138* probably null Het
Smg6 T A 11: 74,930,213 S437T probably benign Het
Spaca9 G T 2: 28,695,993 Q20K probably damaging Het
Spatc1 T G 15: 76,268,293 I41S probably damaging Het
Spink5 A T 18: 43,963,318 T5S possibly damaging Het
St3gal1 C A 15: 67,109,655 probably benign Het
Stat5a C A 11: 100,863,135 T97K probably benign Het
Stat5b A T 11: 100,798,330 I246N probably benign Het
Supt6 G T 11: 78,227,003 D462E probably damaging Het
Swi5 A T 2: 32,281,824 probably benign Het
Syne1 A T 10: 5,405,435 V375E probably damaging Het
Tcp1 T C 17: 12,924,352 F516S probably benign Het
Tgfbr3 A T 5: 107,140,423 N457K probably benign Het
Tmem209 A G 6: 30,487,381 M500T probably damaging Het
Tmem44 C T 16: 30,517,463 probably benign Het
Ttc21a T A 9: 119,939,154 probably benign Het
Ttn T A 2: 76,836,003 I88F possibly damaging Het
Ttn A G 2: 76,871,110 probably benign Het
Ube2w T C 1: 16,602,255 probably benign Het
Ufc1 C T 1: 171,289,954 probably benign Het
Uhmk1 A G 1: 170,212,402 M132T possibly damaging Het
Usp29 A G 7: 6,963,182 N675D possibly damaging Het
Vmn1r23 A G 6: 57,926,484 V103A possibly damaging Het
Wdr59 G T 8: 111,521,972 R4S possibly damaging Het
Zc3hav1 T A 6: 38,307,437 E914D probably benign Het
Other mutations in Tdrd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Tdrd7 APN 4 46010889 missense probably damaging 1.00
IGL01541:Tdrd7 APN 4 46018551 missense possibly damaging 0.90
IGL01901:Tdrd7 APN 4 45989225 splice site probably benign
IGL02812:Tdrd7 APN 4 45994406 missense probably benign 0.08
A5278:Tdrd7 UTSW 4 46007622 missense probably benign 0.01
R0049:Tdrd7 UTSW 4 45987582 missense probably damaging 1.00
R0049:Tdrd7 UTSW 4 45987582 missense probably damaging 1.00
R0389:Tdrd7 UTSW 4 46016987 missense probably benign 0.01
R0639:Tdrd7 UTSW 4 45989102 missense probably benign 0.00
R0681:Tdrd7 UTSW 4 46016879 missense probably benign 0.45
R0925:Tdrd7 UTSW 4 46025758 missense probably damaging 1.00
R0944:Tdrd7 UTSW 4 46029762 missense probably benign 0.01
R1586:Tdrd7 UTSW 4 45994445 missense probably benign 0.39
R1770:Tdrd7 UTSW 4 45987681 splice site probably benign
R1945:Tdrd7 UTSW 4 45965474 missense probably benign 0.00
R4400:Tdrd7 UTSW 4 46005540 missense possibly damaging 0.87
R4457:Tdrd7 UTSW 4 46007526 missense probably benign 0.04
R4898:Tdrd7 UTSW 4 46005616 missense possibly damaging 0.94
R5152:Tdrd7 UTSW 4 46013191 missense probably damaging 1.00
R5197:Tdrd7 UTSW 4 46034350 missense probably damaging 1.00
R5326:Tdrd7 UTSW 4 46029757 missense probably benign 0.01
R5473:Tdrd7 UTSW 4 46020877 missense possibly damaging 0.95
R5524:Tdrd7 UTSW 4 46034301 missense probably benign 0.31
R5542:Tdrd7 UTSW 4 46029757 missense probably benign 0.01
R5554:Tdrd7 UTSW 4 46005358 missense possibly damaging 0.92
R5588:Tdrd7 UTSW 4 45992225 missense probably benign 0.18
R5776:Tdrd7 UTSW 4 46005689 missense probably benign 0.00
R5786:Tdrd7 UTSW 4 45989082 missense probably benign 0.09
R6063:Tdrd7 UTSW 4 46005486 missense probably benign 0.00
R6340:Tdrd7 UTSW 4 45994517 missense probably damaging 0.99
R7130:Tdrd7 UTSW 4 46029693 missense probably damaging 1.00
X0063:Tdrd7 UTSW 4 45992268 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGAGGCTGTGTAAGAACAACTGTCC -3'
(R):5'- CAAGTCCAACACTTTCTGTGCTGC -3'

Sequencing Primer
(F):5'- tcccttcatcacagtcaacag -3'
(R):5'- TCTCTGTACTCTAAATAGGGGGAAAG -3'
Posted On2013-05-23