Incidental Mutation 'R5155:Pum2'
ID396683
Institutional Source Beutler Lab
Gene Symbol Pum2
Ensembl Gene ENSMUSG00000020594
Gene Namepumilio RNA-binding family member 2
Synonyms5730503J23Rik, Pumm2
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.425) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location8674134-8752581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8713572 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 243 (V243A)
Ref Sequence ENSEMBL: ENSMUSP00000126876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020915] [ENSMUST00000111122] [ENSMUST00000111123] [ENSMUST00000163569] [ENSMUST00000163730] [ENSMUST00000165293] [ENSMUST00000166965] [ENSMUST00000168361] [ENSMUST00000169089] [ENSMUST00000169750] [ENSMUST00000170037] [ENSMUST00000178015]
Predicted Effect probably benign
Transcript: ENSMUST00000020915
AA Change: V243A

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020915
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 319 336 N/A INTRINSIC
low complexity region 353 378 N/A INTRINSIC
low complexity region 464 490 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 542 576 N/A INTRINSIC
low complexity region 591 609 N/A INTRINSIC
Pumilio 642 677 2.35e-7 SMART
Pumilio 678 713 6.54e-6 SMART
Pumilio 714 749 2.89e-7 SMART
Pumilio 750 785 3.37e-8 SMART
Pumilio 786 821 4.84e-9 SMART
Pumilio 822 857 3.2e-9 SMART
Pumilio 858 893 5.78e-7 SMART
Pumilio 901 936 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111122
AA Change: V243A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106751
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111123
AA Change: V243A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106752
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163569
AA Change: V243A

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131074
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163730
Predicted Effect probably benign
Transcript: ENSMUST00000165293
Predicted Effect probably benign
Transcript: ENSMUST00000166965
Predicted Effect possibly damaging
Transcript: ENSMUST00000168361
AA Change: V243A

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128292
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169089
AA Change: V243A

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132122
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169750
AA Change: V243A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126876
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170037
Predicted Effect unknown
Transcript: ENSMUST00000171418
AA Change: V104A
SMART Domains Protein: ENSMUSP00000126616
Gene: ENSMUSG00000020594
AA Change: V104A

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
low complexity region 131 152 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
low complexity region 214 234 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178015
AA Change: V243A

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137020
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of RNA-binding proteins. The encoded protein functions as a translational repressor during embryonic development and cell differentiation. This protein is also thought to be a positive regulator of cell proliferation in adipose-derived stem cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit significantly smaller testes and seminiferous tubule degeneration but are otherwise viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Pum2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Pum2 APN 12 8733381 missense probably damaging 1.00
IGL02118:Pum2 APN 12 8729117 missense probably benign 0.31
IGL02185:Pum2 APN 12 8748955 critical splice donor site probably null
IGL02528:Pum2 APN 12 8728696 nonsense probably null
IGL02718:Pum2 APN 12 8733344 missense probably benign 0.02
PIT4366001:Pum2 UTSW 12 8733390 missense probably damaging 1.00
R0152:Pum2 UTSW 12 8728754 missense possibly damaging 0.94
R0317:Pum2 UTSW 12 8728754 missense possibly damaging 0.94
R0357:Pum2 UTSW 12 8721785 missense possibly damaging 0.92
R0413:Pum2 UTSW 12 8713464 missense probably benign 0.00
R0494:Pum2 UTSW 12 8721736 nonsense probably null
R0520:Pum2 UTSW 12 8721710 missense probably damaging 1.00
R0727:Pum2 UTSW 12 8744465 missense probably damaging 1.00
R1576:Pum2 UTSW 12 8713524 missense probably benign 0.01
R2035:Pum2 UTSW 12 8728638 nonsense probably null
R2060:Pum2 UTSW 12 8728726 nonsense probably null
R2422:Pum2 UTSW 12 8748931 missense possibly damaging 0.70
R2437:Pum2 UTSW 12 8744654 missense probably benign 0.19
R3767:Pum2 UTSW 12 8719076 nonsense probably null
R4715:Pum2 UTSW 12 8747272 missense probably damaging 1.00
R5226:Pum2 UTSW 12 8713458 missense possibly damaging 0.73
R5323:Pum2 UTSW 12 8744706 missense probably damaging 1.00
R6250:Pum2 UTSW 12 8744755 splice site probably null
R6253:Pum2 UTSW 12 8748205 missense probably damaging 1.00
R6508:Pum2 UTSW 12 8748861 missense probably benign 0.17
R6953:Pum2 UTSW 12 8728779 critical splice donor site probably null
R7135:Pum2 UTSW 12 8728952 missense possibly damaging 0.80
X0039:Pum2 UTSW 12 8728944 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GAAGTAGTTGAGCGCCTTGG -3'
(R):5'- GTCCTCTGAAAGAGCTATCCAG -3'

Sequencing Primer
(F):5'- TGGCCCTAGTACTAATCCCCCAG -3'
(R):5'- ACATCGCAATTCTCATTAAAAAGC -3'
Posted On2016-06-21