Incidental Mutation 'R5156:Neu4'
ID396708
Institutional Source Beutler Lab
Gene Symbol Neu4
Ensembl Gene ENSMUSG00000034000
Gene Namesialidase 4
Synonyms
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location94020451-94028334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94024455 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 182 (V182A)
Ref Sequence ENSEMBL: ENSMUSP00000140127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050890] [ENSMUST00000190212]
Predicted Effect probably damaging
Transcript: ENSMUST00000050890
AA Change: V159A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051151
Gene: ENSMUSG00000034000
AA Change: V159A

DomainStartEndE-ValueType
Pfam:BNR_3 24 256 5.8e-10 PFAM
Pfam:BNR_2 34 270 2e-29 PFAM
SCOP:d3sil__ 371 448 4e-12 SMART
PDB:2F13|A 371 455 8e-12 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000190212
AA Change: V182A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140127
Gene: ENSMUSG00000034000
AA Change: V182A

DomainStartEndE-ValueType
Pfam:BNR_3 47 279 1.6e-6 PFAM
Pfam:BNR_2 58 304 4.6e-25 PFAM
SCOP:d3sil__ 394 471 4e-12 SMART
PDB:2F29|B 394 478 1e-11 PDB
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of glycohydrolytic enzymes, which remove terminal sialic acid residues from various sialo derivatives, such as glycoproteins, glycolipids, oligosaccharides, and gangliosides. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele are largely normal except increased lipid content in the lung and liver and vacuolization indicative of lysosomal storage disorder. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Neu4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02367:Neu4 APN 1 94024491 missense probably damaging 1.00
IGL03348:Neu4 APN 1 94024974 missense possibly damaging 0.77
R0018:Neu4 UTSW 1 94025338 missense probably benign 0.00
R0018:Neu4 UTSW 1 94025338 missense probably benign 0.00
R0645:Neu4 UTSW 1 94022469 missense probably damaging 1.00
R0813:Neu4 UTSW 1 94022876 frame shift probably null
R0814:Neu4 UTSW 1 94022876 frame shift probably null
R2056:Neu4 UTSW 1 94022450 missense possibly damaging 0.77
R4354:Neu4 UTSW 1 94024557 missense probably damaging 1.00
R4922:Neu4 UTSW 1 94022478 missense probably damaging 0.98
R5268:Neu4 UTSW 1 94024947 missense probably benign 0.18
R5447:Neu4 UTSW 1 94022418 missense probably damaging 1.00
R5862:Neu4 UTSW 1 94022930 missense probably benign 0.20
R6280:Neu4 UTSW 1 94025151 missense probably damaging 1.00
R6697:Neu4 UTSW 1 94025030 missense probably benign 0.00
R7192:Neu4 UTSW 1 94025141 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCTTCCACATGCCCATAG -3'
(R):5'- AGAAAGTCTCCATCTACCGCAG -3'

Sequencing Primer
(F):5'- TTCCACATGCCCATAGTTACAAATAC -3'
(R):5'- ACTCTCCAGAGCGTAGGTTG -3'
Posted On2016-06-21