Incidental Mutation 'R5156:Csf1'
ID396718
Institutional Source Beutler Lab
Gene Symbol Csf1
Ensembl Gene ENSMUSG00000014599
Gene Namecolony stimulating factor 1 (macrophage)
Synonymscolony-stimulating factor-1, CSF-1, Csfm, M-CSF
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.598) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107741048-107760469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107748936 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 148 (T148S)
Ref Sequence ENSEMBL: ENSMUSP00000119553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014743] [ENSMUST00000118593] [ENSMUST00000120243] [ENSMUST00000120654] [ENSMUST00000153114] [ENSMUST00000156820]
Predicted Effect probably benign
Transcript: ENSMUST00000014743
AA Change: T260S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000014743
Gene: ENSMUSG00000014599
AA Change: T260S

DomainStartEndE-ValueType
Pfam:CSF-1 1 254 6.8e-91 PFAM
Pfam:CSF-1 272 552 1.1e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118593
SMART Domains Protein: ENSMUSP00000113136
Gene: ENSMUSG00000014599

DomainStartEndE-ValueType
Pfam:CSF-1 1 257 9.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120243
AA Change: T260S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113617
Gene: ENSMUSG00000014599
AA Change: T260S

DomainStartEndE-ValueType
Pfam:CSF-1 1 254 6.8e-91 PFAM
Pfam:CSF-1 272 552 1.1e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120654
SMART Domains Protein: ENSMUSP00000112832
Gene: ENSMUSG00000014599

DomainStartEndE-ValueType
Pfam:CSF-1 31 163 1.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153114
SMART Domains Protein: ENSMUSP00000115480
Gene: ENSMUSG00000014599

DomainStartEndE-ValueType
Pfam:CSF-1 26 182 1.1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155557
Predicted Effect probably benign
Transcript: ENSMUST00000156820
AA Change: T148S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000119553
Gene: ENSMUSG00000014599
AA Change: T148S

DomainStartEndE-ValueType
Pfam:CSF-1 15 142 6e-37 PFAM
Pfam:CSF-1 160 279 4.9e-52 PFAM
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of macrophages. The active form of the protein is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. The encoded protein may be involved in development of the placenta. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit lack of incisors, a broad domed skull, short thick limb bones with reduced marrow cavities, impaired hearing and vision, and reduced fertility in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Csf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Csf1 APN 3 107756727 missense probably benign 0.00
IGL00907:Csf1 APN 3 107750346 missense probably damaging 1.00
IGL01644:Csf1 APN 3 107753842 missense possibly damaging 0.84
R0022:Csf1 UTSW 3 107753862 missense probably damaging 0.99
R0025:Csf1 UTSW 3 107748644 missense probably benign
R0025:Csf1 UTSW 3 107748644 missense probably benign
R0350:Csf1 UTSW 3 107748606 missense probably benign 0.01
R1392:Csf1 UTSW 3 107756630 missense probably benign 0.03
R1392:Csf1 UTSW 3 107756630 missense probably benign 0.03
R1531:Csf1 UTSW 3 107748338 missense possibly damaging 0.72
R1897:Csf1 UTSW 3 107748279 missense probably damaging 1.00
R4373:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4375:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4376:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4377:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4469:Csf1 UTSW 3 107750681 critical splice donor site probably null
R4474:Csf1 UTSW 3 107753856 missense probably damaging 0.98
R4604:Csf1 UTSW 3 107756962 intron probably null
R4634:Csf1 UTSW 3 107749167 missense probably damaging 0.96
R5086:Csf1 UTSW 3 107748710 missense possibly damaging 0.72
R5425:Csf1 UTSW 3 107748896 missense possibly damaging 0.96
R6120:Csf1 UTSW 3 107753854 missense probably damaging 0.96
R6268:Csf1 UTSW 3 107747157 missense possibly damaging 0.86
R6269:Csf1 UTSW 3 107749001 missense probably benign 0.04
R6273:Csf1 UTSW 3 107749163 missense probably damaging 1.00
R6298:Csf1 UTSW 3 107748359 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGGAAAACTTTGCTTCCTGG -3'
(R):5'- TGCCTGTACCCTAAAGCCAC -3'

Sequencing Primer
(F):5'- GCTTCCTGGGTCAAAAATCCC -3'
(R):5'- AGCCACCCCTAGCAGTG -3'
Posted On2016-06-21