Incidental Mutation 'R5156:0610010F05Rik'
List |< first << previous [record 44 of 386652] next >> last >|
ID396740
Institutional Source Beutler Lab
Gene Symbol 0610010F05Rik
Ensembl Gene ENSMUSG00000042208
Gene NameRIKEN cDNA 0610010F05 gene
Synonyms
Accession Numbers
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location23564961-23633631 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) A to G at 23593424 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043356] [ENSMUST00000093267] [ENSMUST00000109532] [ENSMUST00000123909] [ENSMUST00000155903] [ENSMUST00000180260]
Predicted Effect probably null
Transcript: ENSMUST00000043356
SMART Domains Protein: ENSMUSP00000044265
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093267
SMART Domains Protein: ENSMUSP00000090955
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
Pfam:DUF3342 1 303 7.7e-107 PFAM
low complexity region 419 430 N/A INTRINSIC
low complexity region 433 450 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109532
SMART Domains Protein: ENSMUSP00000105158
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123909
SMART Domains Protein: ENSMUSP00000117103
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000155903
SMART Domains Protein: ENSMUSP00000137799
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 1e-106 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000180260
SMART Domains Protein: ENSMUSP00000136118
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 4.5e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik G T 17: 79,628,209 L255F possibly damaging Het
AC107766.1 A G 1: 34,723,274 E64G noncoding transcript Het
Adgrv1 T A 13: 81,520,642 T885S noncoding transcript Het
Apeh C T 9: 108,094,287 A54T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
C87414 G A 5: 93,638,705 T104I noncoding transcript Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 H137L noncoding transcript Het
Cfap53 T A 18: 74,359,767 N133K noncoding transcript Het
Clca3a2 T A 3: 144,805,838 T159S not run Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Ctage5 A G 12: 59,172,537 D96G noncoding transcript Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 T103A noncoding transcript Het
Gm6818 A T 7: 38,402,047 I241N noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M385K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 T151S noncoding transcript Het
Muc19 T A 15: 91,900,420 V900E noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Nrap A G 19: 56,371,845 M466T probably benign Het
Nt5m A T 11: 59,874,661 I218F noncoding transcript Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 unknown Het
Ppp1r37 T C 7: 19,561,975 D19G unknown Het
Rfx4 T C 10: 84,868,354 Y287H not run Het
RP23-3C4.2 T G 3: 98,124,310 L908R noncoding transcript Het
Sec13 G A 6: 113,730,876 Q16* probably null Het
Serhl G A 15: 83,102,694 G154E noncoding transcript Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 M23K noncoding transcript Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsfm13 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I543V noncoding transcript Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T54K probably damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in 0610010F05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:0610010F05Rik APN 11 23595434 missense probably damaging 1.00
IGL01444:0610010F05Rik APN 11 23620225 splice donor site probably benign 0.00
IGL01522:0610010F05Rik APN 11 23582865 critical splice donor site probably null 0.00
IGL01819:0610010F05Rik APN 11 23584561 missense probably damaging 1.00
IGL02470:0610010F05Rik APN 11 23615222 missense probably damaging 1.00
IGL03046:0610010F05Rik UTSW 11 23615150 missense possibly damaging 0.77
R0139:0610010F05Rik UTSW 11 23620214 splice donor site probably benign
R0334:0610010F05Rik UTSW 11 23617129 splice donor site probably benign
R0646:0610010F05Rik UTSW 11 23575491 missense probably damaging 0.99
R1078:0610010F05Rik UTSW 11 23611762 missense possibly damaging 0.64
R1263:0610010F05Rik UTSW 11 23620278 nonsense probably null
R1353:0610010F05Rik UTSW 11 23620217 splice donor site probably benign
R1471:0610010F05Rik UTSW 11 23615222 missense probably damaging 1.00
R1568:0610010F05Rik UTSW 11 23589971 missense possibly damaging 0.90
R2163:0610010F05Rik UTSW 11 23576826 splice acceptor site probably benign
R2318:0610010F05Rik UTSW 11 23588701 missense probably damaging 1.00
R2426:0610010F05Rik UTSW 11 23576801 missense probably damaging 1.00
R4373:0610010F05Rik UTSW 11 23615265 unclassified probably null
R4688:0610010F05Rik UTSW 11 23593449 missense probably benign
R4816:0610010F05Rik UTSW 11 23615243 missense possibly damaging 0.67
R5046:0610010F05Rik UTSW 11 23620354 missense probably benign 0.23
R5249:0610010F05Rik UTSW 11 23575483 makesense probably null
R5615:0610010F05Rik UTSW 11 23606759 missense probably damaging 0.96
X0026:0610010F05Rik UTSW 11 23576767 missense probably benign 0.00
X0067:0610010F05Rik UTSW 11 23593420 splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGGAACAAAATATGGACTTACATT -3'
(R):5'- CGCTTTAGCCCCTCCTGTAAAT -3'

Sequencing Primer
(F):5'- TCACGAATGGTTGTGAGCCAC -3'
(R):5'- AGCCCCTCCTGTAAATTGTTAAG -3'
Posted OnJun 21, 2016