Incidental Mutation 'R5156:Mia2'
ID396744
Institutional Source Beutler Lab
Gene Symbol Mia2
Ensembl Gene ENSMUSG00000021000
Gene Namemelanoma inhibitory activity 2
Synonyms
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location59095799-59191583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59172537 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 436 (T436A)
Ref Sequence ENSEMBL: ENSMUSP00000135618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069430] [ENSMUST00000170992] [ENSMUST00000175877] [ENSMUST00000175912] [ENSMUST00000176322] [ENSMUST00000176336] [ENSMUST00000176464] [ENSMUST00000176727] [ENSMUST00000176752] [ENSMUST00000176892] [ENSMUST00000177162] [ENSMUST00000177225] [ENSMUST00000219140]
Predicted Effect probably benign
Transcript: ENSMUST00000069430
AA Change: T462A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000070572
Gene: ENSMUSG00000021000
AA Change: T462A

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 124 253 9e-6 SMART
SCOP:d1fxkc_ 314 437 3e-16 SMART
low complexity region 480 493 N/A INTRINSIC
low complexity region 533 556 N/A INTRINSIC
low complexity region 682 700 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 751 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170992
AA Change: T440A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126538
Gene: ENSMUSG00000021000
AA Change: T440A

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 102 231 2e-6 SMART
SCOP:d1fxkc_ 292 415 2e-17 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
low complexity region 700 720 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175659
Predicted Effect unknown
Transcript: ENSMUST00000175837
AA Change: T114A
SMART Domains Protein: ENSMUSP00000134828
Gene: ENSMUSG00000021000
AA Change: T114A

DomainStartEndE-ValueType
SCOP:d1fxkc_ 3 90 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175877
AA Change: T412A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000135440
Gene: ENSMUSG00000021000
AA Change: T412A

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d1fxkc_ 74 203 1e-5 SMART
SCOP:d1fxkc_ 264 387 6e-16 SMART
low complexity region 430 443 N/A INTRINSIC
low complexity region 589 607 N/A INTRINSIC
low complexity region 614 624 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
low complexity region 658 682 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175912
AA Change: T453A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135251
Gene: ENSMUSG00000021000
AA Change: T453A

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 115 244 8e-6 SMART
SCOP:d1fxkc_ 305 428 2e-16 SMART
low complexity region 471 484 N/A INTRINSIC
low complexity region 524 547 N/A INTRINSIC
low complexity region 673 691 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 713 733 N/A INTRINSIC
low complexity region 742 766 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176223
Predicted Effect probably benign
Transcript: ENSMUST00000176322
AA Change: T473A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135100
Gene: ENSMUSG00000021000
AA Change: T473A

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 135 264 4e-6 SMART
SCOP:d1fxkc_ 325 448 9e-17 SMART
low complexity region 491 504 N/A INTRINSIC
low complexity region 544 567 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 718 728 N/A INTRINSIC
low complexity region 733 753 N/A INTRINSIC
low complexity region 762 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176336
AA Change: T429A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134872
Gene: ENSMUSG00000021000
AA Change: T429A

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
coiled coil region 55 235 N/A INTRINSIC
SCOP:d1fxkc_ 281 404 6e-8 SMART
low complexity region 447 460 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176464
AA Change: T464A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135390
Gene: ENSMUSG00000021000
AA Change: T464A

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 4e-6 SMART
SCOP:d1fxkc_ 316 439 8e-17 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 535 558 N/A INTRINSIC
low complexity region 684 702 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 753 777 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000176617
Predicted Effect probably benign
Transcript: ENSMUST00000176727
SMART Domains Protein: ENSMUSP00000135694
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176752
SMART Domains Protein: ENSMUSP00000134972
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176892
AA Change: T429A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135245
Gene: ENSMUSG00000021000
AA Change: T429A

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 91 220 4e-6 SMART
SCOP:d1fxkc_ 281 404 8e-17 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
low complexity region 649 667 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 718 742 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177162
AA Change: T464A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135001
Gene: ENSMUSG00000021000
AA Change: T464A

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 2e-5 SMART
SCOP:d1fxkc_ 316 439 8e-16 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
low complexity region 666 676 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
low complexity region 710 734 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177222
Predicted Effect possibly damaging
Transcript: ENSMUST00000177225
AA Change: T436A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135618
Gene: ENSMUSG00000021000
AA Change: T436A

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
SCOP:d1fxkc_ 98 227 3e-5 SMART
SCOP:d1fxkc_ 288 411 2e-15 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 613 631 N/A INTRINSIC
low complexity region 638 648 N/A INTRINSIC
low complexity region 653 673 N/A INTRINSIC
low complexity region 682 706 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000219140
AA Change: T1065A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in endoplasmic reticulum-to-Golgi trafficking and regulation of cholesterol metabolism. Three major classes of transcripts are generated from this gene- melanoma inhibitory activity 2-specific transcripts, cTAGE family member 5-specific transcripts and transcripts that include exons from both these transcript species. Additionally, alternative splicing in these transcripts results in multiple transcript variants encoding diverse isoforms. A mutation in this gene (couch-potato or cpto) may result in low levels of plasma cholesterol and triglycerides. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit decreased serum levels of cholesterol, HDL cholesterol, triglyceride, and VLDL triglyceride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Mia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Mia2 APN 12 59160273 splice site probably benign
IGL00791:Mia2 APN 12 59108299 missense possibly damaging 0.82
IGL00821:Mia2 APN 12 59170320 critical splice donor site probably null
IGL00901:Mia2 APN 12 59108029 missense probably damaging 1.00
IGL00985:Mia2 APN 12 59188360 missense probably damaging 1.00
IGL01304:Mia2 APN 12 59104538 missense probably damaging 1.00
IGL01909:Mia2 APN 12 59107945 missense possibly damaging 0.94
IGL02646:Mia2 APN 12 59108836 missense probably damaging 1.00
IGL02800:Mia2 APN 12 59188491 nonsense probably null
IGL03332:Mia2 APN 12 59108398 missense probably damaging 0.97
PIT4812001:Mia2 UTSW 12 59101579 missense possibly damaging 0.92
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0449:Mia2 UTSW 12 59172594 critical splice donor site probably null
R0620:Mia2 UTSW 12 59154419 missense possibly damaging 0.96
R0622:Mia2 UTSW 12 59131578 missense probably damaging 0.98
R0632:Mia2 UTSW 12 59136143 missense probably damaging 0.99
R1643:Mia2 UTSW 12 59179845 splice site probably null
R1654:Mia2 UTSW 12 59108833 missense possibly damaging 0.92
R1706:Mia2 UTSW 12 59144766 nonsense probably null
R1776:Mia2 UTSW 12 59149575 splice site probably benign
R1848:Mia2 UTSW 12 59170251 splice site probably benign
R2240:Mia2 UTSW 12 59107882 missense probably benign 0.01
R2698:Mia2 UTSW 12 59170994 critical splice donor site probably null
R2860:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2861:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2862:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R3429:Mia2 UTSW 12 59189641 missense possibly damaging 0.89
R3861:Mia2 UTSW 12 59109021 missense probably benign 0.00
R3965:Mia2 UTSW 12 59176372 missense probably damaging 1.00
R5249:Mia2 UTSW 12 59108125 missense probably damaging 0.99
R5330:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5331:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5815:Mia2 UTSW 12 59174106 missense possibly damaging 0.95
R5972:Mia2 UTSW 12 59146937 missense probably damaging 1.00
R6651:Mia2 UTSW 12 59154362 missense possibly damaging 0.78
R6676:Mia2 UTSW 12 59108370 missense probably damaging 0.97
R6695:Mia2 UTSW 12 59172580 missense probably damaging 0.99
R6800:Mia2 UTSW 12 59188546 critical splice donor site probably null
R6845:Mia2 UTSW 12 59184278 nonsense probably null
R6919:Mia2 UTSW 12 59129895 missense possibly damaging 0.74
R7058:Mia2 UTSW 12 59184235 missense possibly damaging 0.77
R7209:Mia2 UTSW 12 59154390 missense possibly damaging 0.55
R7274:Mia2 UTSW 12 59108119 missense probably damaging 0.99
R7291:Mia2 UTSW 12 59158369 critical splice donor site probably null
X0063:Mia2 UTSW 12 59136139 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGGCATGAAACTCATTCCTC -3'
(R):5'- AAAGTGCCACTGTAGTAGCC -3'

Sequencing Primer
(F):5'- GGCATGAAACTCATTCCTCTATTG -3'
(R):5'- GAGATTCTGTGGGAACTACAA -3'
Posted On2016-06-21