Incidental Mutation 'R5156:Ttc23l'
ID396748
Institutional Source Beutler Lab
Gene Symbol Ttc23l
Ensembl Gene ENSMUSG00000022249
Gene Nametetratricopeptide repeat domain 23-like
Synonyms4930401A09Rik
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location10500102-10558668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 10551550 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 30 (T30K)
Ref Sequence ENSEMBL: ENSMUSP00000022857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022857] [ENSMUST00000166039] [ENSMUST00000167842] [ENSMUST00000167842]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022857
AA Change: T30K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022857
Gene: ENSMUSG00000022249
AA Change: T30K

DomainStartEndE-ValueType
TPR 159 192 4.21e1 SMART
Blast:TPR 208 239 2e-6 BLAST
TPR 250 283 1.4e1 SMART
low complexity region 292 303 N/A INTRINSIC
TPR 376 409 9.53e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166039
SMART Domains Protein: ENSMUSP00000131180
Gene: ENSMUSG00000022249

DomainStartEndE-ValueType
Blast:TPR 183 209 9e-11 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000167842
AA Change: T30K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127781
Gene: ENSMUSG00000022249
AA Change: T30K

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:TPR_1 102 133 3.3e-6 PFAM
low complexity region 148 160 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167842
AA Change: T30K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Ttc23l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ttc23l APN 15 10530689 missense probably damaging 1.00
IGL01319:Ttc23l APN 15 10509406 splice site probably benign
IGL01562:Ttc23l APN 15 10551390 splice site probably benign
IGL01969:Ttc23l APN 15 10551434 nonsense probably null
IGL03172:Ttc23l APN 15 10537566 missense probably benign 0.06
R0042:Ttc23l UTSW 15 10551541 missense probably damaging 1.00
R0042:Ttc23l UTSW 15 10551541 missense probably damaging 1.00
R0335:Ttc23l UTSW 15 10539963 missense probably benign 0.26
R0554:Ttc23l UTSW 15 10530657 missense probably benign 0.12
R0609:Ttc23l UTSW 15 10504536 missense probably benign
R0631:Ttc23l UTSW 15 10539980 missense probably damaging 1.00
R1703:Ttc23l UTSW 15 10523658 missense probably damaging 1.00
R2106:Ttc23l UTSW 15 10547256 missense probably damaging 1.00
R2220:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2276:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2277:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2278:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2279:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2368:Ttc23l UTSW 15 10537562 small insertion probably benign
R2368:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2420:Ttc23l UTSW 15 10537562 small insertion probably benign
R2420:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2421:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2422:Ttc23l UTSW 15 10537562 small insertion probably benign
R2422:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2830:Ttc23l UTSW 15 10537562 small insertion probably benign
R2831:Ttc23l UTSW 15 10537562 small insertion probably benign
R2831:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2979:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2980:Ttc23l UTSW 15 10537562 small insertion probably benign
R2980:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2981:Ttc23l UTSW 15 10537562 small insertion probably benign
R2981:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2982:Ttc23l UTSW 15 10537562 small insertion probably benign
R2982:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2983:Ttc23l UTSW 15 10537562 small insertion probably benign
R2983:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3176:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3177:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3276:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3277:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3722:Ttc23l UTSW 15 10537562 small insertion probably benign
R3722:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3743:Ttc23l UTSW 15 10537562 small insertion probably benign
R3743:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3767:Ttc23l UTSW 15 10530695 missense possibly damaging 0.94
R3921:Ttc23l UTSW 15 10537562 small insertion probably benign
R3921:Ttc23l UTSW 15 10537563 small insertion probably benign
R3921:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4091:Ttc23l UTSW 15 10537562 small insertion probably benign
R4091:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4119:Ttc23l UTSW 15 10539920 missense probably damaging 1.00
R4120:Ttc23l UTSW 15 10539920 missense probably damaging 1.00
R4373:Ttc23l UTSW 15 10537562 small insertion probably benign
R4373:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4375:Ttc23l UTSW 15 10537562 small insertion probably benign
R4375:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4376:Ttc23l UTSW 15 10537562 small insertion probably benign
R4376:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4377:Ttc23l UTSW 15 10537562 small insertion probably benign
R4377:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R5002:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5106:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5107:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5109:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5157:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5160:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5161:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5259:Ttc23l UTSW 15 10515150 missense probably damaging 0.99
R5307:Ttc23l UTSW 15 10533659 missense probably damaging 1.00
R5728:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5756:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5772:Ttc23l UTSW 15 10551469 missense probably benign 0.01
R5793:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5794:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5847:Ttc23l UTSW 15 10537596 missense probably benign 0.07
R6976:Ttc23l UTSW 15 10537580 nonsense probably null
R7010:Ttc23l UTSW 15 10515138 missense probably damaging 1.00
Z1088:Ttc23l UTSW 15 10533667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGCTTTCAAATGACAACCTG -3'
(R):5'- CCACACTGCTGGCTTAGAAG -3'

Sequencing Primer
(F):5'- TGCTTTCAAATGACAACCTGAACCC -3'
(R):5'- CTTAGAAGCTAGGTCTTGAGAGTAG -3'
Posted On2016-06-21