Incidental Mutation 'R5156:Serhl'
ID396749
Institutional Source Beutler Lab
Gene Symbol Serhl
Ensembl Gene ENSMUSG00000058586
Gene Nameserine hydrolase-like
Synonyms1110019M09Rik
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location83089506-83116674 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 83102694 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000078218] [ENSMUST00000166427] [ENSMUST00000167389] [ENSMUST00000167862] [ENSMUST00000168029]
Predicted Effect probably benign
Transcript: ENSMUST00000078218
SMART Domains Protein: ENSMUSP00000077345
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 28 282 1.4e-10 PFAM
Pfam:Abhydrolase_6 29 295 2.9e-28 PFAM
Pfam:Abhydrolase_1 53 260 1.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165371
Predicted Effect probably benign
Transcript: ENSMUST00000166427
SMART Domains Protein: ENSMUSP00000132686
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Hydrolase_4 33 194 7.4e-11 PFAM
Pfam:Abhydrolase_1 37 299 4e-20 PFAM
Pfam:Abhydrolase_5 38 292 4.4e-10 PFAM
Pfam:Abhydrolase_6 39 305 6.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167389
SMART Domains Protein: ENSMUSP00000128251
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Abhydrolase_6 2 54 4.3e-8 PFAM
Pfam:Abhydrolase_1 3 54 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167750
Predicted Effect probably benign
Transcript: ENSMUST00000167862
Predicted Effect probably benign
Transcript: ENSMUST00000168029
SMART Domains Protein: ENSMUSP00000128802
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Abhydrolase_1 1 96 3.3e-15 PFAM
Pfam:Abhydrolase_6 1 97 2.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169702
Predicted Effect probably benign
Transcript: ENSMUST00000169814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172101
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Serhl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Serhl APN 15 83104373 missense probably benign 0.15
IGL00425:Serhl APN 15 83105637 missense possibly damaging 0.79
R1544:Serhl UTSW 15 83105676 missense probably damaging 1.00
R2119:Serhl UTSW 15 83115575 missense probably benign 0.19
R2320:Serhl UTSW 15 83101872 missense probably damaging 0.99
R3236:Serhl UTSW 15 83104403 missense probably damaging 0.96
R5256:Serhl UTSW 15 83102634 missense probably damaging 1.00
R5822:Serhl UTSW 15 83116327 missense probably benign 0.02
R5951:Serhl UTSW 15 83103036 unclassified probably benign
R6385:Serhl UTSW 15 83101622 missense probably benign
R6521:Serhl UTSW 15 83101642 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAACTCCATGGTGGGAAAGG -3'
(R):5'- TGGGGAAGGCACAGATTTCAC -3'

Sequencing Primer
(F):5'- CTCCATGGTGGGAAAGGAACTAG -3'
(R):5'- TTTCACCAGAACAGGAGACTTCTGTC -3'
Posted On2016-06-21