Incidental Mutation 'R5156:Muc19'
ID396750
Institutional Source Beutler Lab
Gene Symbol Muc19
Ensembl Gene ENSMUSG00000044021
Gene Namemucin 19
Synonymsapomucin, sld
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location91838326-91934555 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 91900420 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160242
SMART Domains Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 21 34 N/A INTRINSIC
VWD 47 198 1.31e-13 SMART
Pfam:C8 221 293 1.1e-8 PFAM
Pfam:TIL 298 353 1.6e-11 PFAM
VWD 383 545 1.58e-25 SMART
C8 577 651 8.71e-20 SMART
Pfam:TIL 654 711 2.1e-7 PFAM
Pfam:TIL 753 813 5.2e-8 PFAM
VWD 842 1005 2.36e-47 SMART
C8 1041 1115 1.84e-27 SMART
low complexity region 1220 1254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180042
SMART Domains Protein: ENSMUSP00000136207
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
C8 17 91 8.71e-20 SMART
Pfam:TIL 94 151 1.2e-7 PFAM
Pfam:TIL 193 253 6.6e-8 PFAM
VWD 282 445 2.36e-47 SMART
C8 481 555 1.84e-27 SMART
low complexity region 660 701 N/A INTRINSIC
Meta Mutation Damage Score 0.0884 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice homozygous for this spontaneous mutation show a partially arrested mucous cell differentiation of the sublingual glands. Severe inflammatory lesions resembling Sjogren's syndrome develop spontaneously in salivary and lacrimal glands of neonatally thymectomized mutants without any immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Muc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Muc19 APN 15 91886749 exon noncoding transcript
IGL01017:Muc19 APN 15 91880707 exon noncoding transcript
IGL01140:Muc19 APN 15 91899399 exon noncoding transcript
IGL01292:Muc19 APN 15 91894276 exon noncoding transcript
IGL01397:Muc19 APN 15 91894304 exon noncoding transcript
IGL01525:Muc19 APN 15 91886683 exon noncoding transcript
IGL01589:Muc19 APN 15 91870501 exon noncoding transcript
IGL02023:Muc19 APN 15 91888259 exon noncoding transcript
IGL02088:Muc19 APN 15 91891168 splice site noncoding transcript
IGL02168:Muc19 APN 15 91894098 exon noncoding transcript
IGL02343:Muc19 APN 15 91894234 exon noncoding transcript
IGL02402:Muc19 APN 15 91893998 splice site noncoding transcript
IGL02433:Muc19 APN 15 91872496 exon noncoding transcript
IGL02533:Muc19 APN 15 91898047 exon noncoding transcript
IGL02558:Muc19 APN 15 91897622 exon noncoding transcript
IGL02652:Muc19 APN 15 91877815 critical splice donor site noncoding transcript
IGL03032:Muc19 APN 15 91910539 unclassified noncoding transcript
IGL02837:Muc19 UTSW 15 91882656 exon noncoding transcript
R0098:Muc19 UTSW 15 91892907 exon noncoding transcript
R0098:Muc19 UTSW 15 91892907 exon noncoding transcript
R0208:Muc19 UTSW 15 91893024 splice site noncoding transcript
R0597:Muc19 UTSW 15 91900502 splice site noncoding transcript
R1185:Muc19 UTSW 15 91878549 exon noncoding transcript
R1185:Muc19 UTSW 15 91878549 exon noncoding transcript
R1469:Muc19 UTSW 15 91874300 unclassified noncoding transcript
R1942:Muc19 UTSW 15 91892472 exon noncoding transcript
R2035:Muc19 UTSW 15 91892405 splice site noncoding transcript
R2208:Muc19 UTSW 15 91871549 exon noncoding transcript
R2877:Muc19 UTSW 15 91893006 exon noncoding transcript
R2897:Muc19 UTSW 15 91924665 critical splice donor site noncoding transcript
R4110:Muc19 UTSW 15 91897622 exon noncoding transcript
R4403:Muc19 UTSW 15 91871570 exon noncoding transcript
R4606:Muc19 UTSW 15 91934383 exon noncoding transcript
R4677:Muc19 UTSW 15 91888217 exon noncoding transcript
R4753:Muc19 UTSW 15 91877761 unclassified noncoding transcript
R4781:Muc19 UTSW 15 91903166 critical splice donor site noncoding transcript
R4869:Muc19 UTSW 15 91897716 exon noncoding transcript
R5000:Muc19 UTSW 15 91873231 unclassified noncoding transcript
R5044:Muc19 UTSW 15 91888138 exon noncoding transcript
R5176:Muc19 UTSW 15 91892180 exon noncoding transcript
R5224:Muc19 UTSW 15 91928025 exon noncoding transcript
R5524:Muc19 UTSW 15 91894393 exon noncoding transcript
R5568:Muc19 UTSW 15 91884274 splice site noncoding transcript
R5592:Muc19 UTSW 15 91930314 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GTGATGTCTTGCTACACTCCAC -3'
(R):5'- CATCATCGAAAGCCTGCAAG -3'

Sequencing Primer
(F):5'- CCTCAGCTAACAGAATTATTGCAG -3'
(R):5'- AGTAGCACAGAGCATACC -3'
Posted On2016-06-21