Incidental Mutation 'R5156:Cfap53'
ID396753
Institutional Source Beutler Lab
Gene Symbol Cfap53
Ensembl Gene ENSMUSG00000035394
Gene Namecilia and flagella associated protein 53
Synonyms4933415I03Rik, Ccdc11
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location74283090-74359986 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to A at 74359767 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114895] [ENSMUST00000176435]
Predicted Effect probably benign
Transcript: ENSMUST00000114895
SMART Domains Protein: ENSMUSP00000110545
Gene: ENSMUSG00000035394

DomainStartEndE-ValueType
low complexity region 131 145 N/A INTRINSIC
Pfam:TPH 160 495 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177407
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the CFAP53 family. It was found to be differentially expressed by the ciliated cells of frog epidermis and in skin fibroblasts from human. Mutations in this gene are associated with visceral heterotaxy-6, which implicates this gene in determination of left-right asymmetric patterning. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Cfap53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Cfap53 APN 18 74305540 nonsense probably null
IGL00667:Cfap53 APN 18 74300192 missense probably damaging 1.00
IGL00917:Cfap53 APN 18 74299296 missense probably benign 0.08
R0009:Cfap53 UTSW 18 74299176 missense probably benign 0.00
R0009:Cfap53 UTSW 18 74299176 missense probably benign 0.00
R0035:Cfap53 UTSW 18 74300207 missense probably damaging 1.00
R0035:Cfap53 UTSW 18 74300207 missense probably damaging 1.00
R0048:Cfap53 UTSW 18 74299173 missense probably benign 0.09
R0601:Cfap53 UTSW 18 74300150 missense possibly damaging 0.94
R0939:Cfap53 UTSW 18 74305730 missense probably null 0.72
R1166:Cfap53 UTSW 18 74300180 missense possibly damaging 0.68
R1588:Cfap53 UTSW 18 74307373 missense probably benign
R2105:Cfap53 UTSW 18 74283223 missense possibly damaging 0.73
R2186:Cfap53 UTSW 18 74329505 splice site probably null
R3723:Cfap53 UTSW 18 74359569 missense probably benign 0.13
R3724:Cfap53 UTSW 18 74359569 missense probably benign 0.13
R3904:Cfap53 UTSW 18 74307374 missense probably damaging 0.99
R5262:Cfap53 UTSW 18 74329459 missense probably benign 0.39
R5928:Cfap53 UTSW 18 74359740 missense possibly damaging 0.90
R6405:Cfap53 UTSW 18 74359606 missense probably damaging 1.00
R6653:Cfap53 UTSW 18 74300209 missense probably damaging 0.97
R6675:Cfap53 UTSW 18 74307376 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGATGCAGATTGCCCACCAG -3'
(R):5'- GCAACCCTCTGTTACCAGAAGC -3'

Sequencing Primer
(F):5'- GATTGCCCACCAGCAGCAG -3'
(R):5'- GAACAAATTCATTTGAAGGAAG -3'
Posted On2016-06-21