Incidental Mutation 'R5156:Olfr1474'
ID396755
Institutional Source Beutler Lab
Gene Symbol Olfr1474
Ensembl Gene ENSMUSG00000096273
Gene Nameolfactory receptor 1474
SynonymsMOR202-42, MOR202-26P, GA_x6K02T2RE5P-3803583-3804527
MMRRC Submission 042738-MU
Accession Numbers

Genbank: NM_001011842.1

Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13469565-13472157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 13471673 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 234 (K234N)
Ref Sequence ENSEMBL: ENSMUSP00000151810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096202] [ENSMUST00000207529] [ENSMUST00000220113]
Predicted Effect probably damaging
Transcript: ENSMUST00000096202
AA Change: K234N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093916
Gene: ENSMUSG00000096273
AA Change: K234N

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1e-7 PFAM
Pfam:7tm_1 39 288 8.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207529
Predicted Effect probably damaging
Transcript: ENSMUST00000220113
AA Change: K234N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

none

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Olfr1474
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03256:Olfr1474 APN 19 13471267 missense probably damaging 0.99
D605:Olfr1474 UTSW 19 13471157 nonsense probably null
R0173:Olfr1474 UTSW 19 13471701 missense probably benign 0.02
R1102:Olfr1474 UTSW 19 13471407 missense probably damaging 0.97
R1515:Olfr1474 UTSW 19 13471680 missense probably damaging 0.97
R1780:Olfr1474 UTSW 19 13471362 missense probably benign 0.14
R2061:Olfr1474 UTSW 19 13471241 missense probably damaging 0.98
R4016:Olfr1474 UTSW 19 13471197 missense possibly damaging 0.95
R4485:Olfr1474 UTSW 19 13471555 missense probably benign 0.08
R5119:Olfr1474 UTSW 19 13471546 missense probably benign 0.00
R5150:Olfr1474 UTSW 19 13471430 missense probably benign 0.01
R5699:Olfr1474 UTSW 19 13470972 start codon destroyed probably null 0.78
R5800:Olfr1474 UTSW 19 13471896 missense probably benign 0.06
R5840:Olfr1474 UTSW 19 13471878 missense probably benign 0.01
R5953:Olfr1474 UTSW 19 13471368 missense possibly damaging 0.92
R5997:Olfr1474 UTSW 19 13471506 missense probably benign 0.12
R6233:Olfr1474 UTSW 19 13471740 missense probably damaging 1.00
R6488:Olfr1474 UTSW 19 13471617 missense probably damaging 1.00
R6847:Olfr1474 UTSW 19 13471038 missense probably benign 0.03
R6964:Olfr1474 UTSW 19 13471361 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGGGATCTTACAATCTTCTGTCC -3'
(R):5'- TGTTCCTCAGGCTGTAGACC -3'

Sequencing Primer
(F):5'- GATCTTACAATCTTCTGTCCATGTTG -3'
(R):5'- CCACAGGGTTCAGCATAGG -3'
Posted On2016-06-21