Incidental Mutation 'R5157:Dzank1'
ID396765
Institutional Source Beutler Lab
Gene Symbol Dzank1
Ensembl Gene ENSMUSG00000037259
Gene Namedouble zinc ribbon and ankyrin repeat domains 1
Synonyms2810039F03Rik, 6330439K17Rik, Ankrd64
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R5157 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location144470557-144527414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144483412 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 545 (H545R)
Ref Sequence ENSEMBL: ENSMUSP00000080643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081982] [ENSMUST00000163701]
Predicted Effect probably damaging
Transcript: ENSMUST00000081982
AA Change: H545R

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080643
Gene: ENSMUSG00000037259
AA Change: H545R

DomainStartEndE-ValueType
Pfam:CHB_HEX_C 11 99 1.1e-16 PFAM
Pfam:CHB_HEX_C_1 20 97 4.5e-18 PFAM
Pfam:Fn3_assoc 32 100 1.6e-17 PFAM
ZnF_RBZ 268 292 5.44e0 SMART
ZnF_RBZ 307 331 2.55e0 SMART
Blast:ZnF_RBZ 355 378 1e-7 BLAST
ZnF_RBZ 385 409 3.13e0 SMART
low complexity region 591 604 N/A INTRINSIC
ANK 631 662 2.97e2 SMART
ANK 666 695 2.83e0 SMART
Blast:ANK 700 731 7e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149523
Predicted Effect possibly damaging
Transcript: ENSMUST00000163701
AA Change: H546R

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133177
Gene: ENSMUSG00000037259
AA Change: H546R

DomainStartEndE-ValueType
Pfam:CHB_HEX_C 12 99 1.5e-17 PFAM
Pfam:CHB_HEX_C_1 21 97 8.5e-17 PFAM
Pfam:Fn3_assoc 32 100 3.7e-18 PFAM
ZnF_RBZ 269 293 5.44e0 SMART
ZnF_RBZ 308 332 2.55e0 SMART
Blast:ZnF_RBZ 356 379 1e-7 BLAST
ZnF_RBZ 386 410 3.13e0 SMART
low complexity region 592 605 N/A INTRINSIC
ANK 632 663 2.97e2 SMART
ANK 667 696 2.83e0 SMART
Blast:ANK 701 732 7e-12 BLAST
Meta Mutation Damage Score 0.276 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains two ankyrin repeat-encoding regions. Ankyrin repeats are tandemly repeated modules of about 33 amino acids described as L-shaped structures consisting of a beta-hairpin and two alpha-helices. Ankyrin repeats occur in a large number of functionally diverse proteins, mainly from eukaryotes, and are known to function as protein-protein interaction domains. Alternative splicing has been observed for this gene but the full-length nature of additional variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Dzank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dzank1 APN 2 144481725 nonsense probably null
IGL00955:Dzank1 APN 2 144490174 missense probably benign 0.22
IGL01888:Dzank1 APN 2 144476154 splice site probably null
IGL02108:Dzank1 APN 2 144506223 missense probably benign 0.02
IGL02979:Dzank1 APN 2 144488738 missense probably damaging 1.00
PIT4466001:Dzank1 UTSW 2 144483373 missense probably benign 0.00
R0388:Dzank1 UTSW 2 144476106 missense possibly damaging 0.86
R0603:Dzank1 UTSW 2 144511512 missense probably benign 0.04
R1052:Dzank1 UTSW 2 144513445 missense probably benign
R1386:Dzank1 UTSW 2 144491831 missense probably benign 0.05
R1529:Dzank1 UTSW 2 144482188 missense probably benign 0.01
R1634:Dzank1 UTSW 2 144481669 missense probably benign 0.01
R2761:Dzank1 UTSW 2 144513449 missense probably benign
R4024:Dzank1 UTSW 2 144482227 missense probably benign
R4279:Dzank1 UTSW 2 144491845 missense probably benign 0.00
R4324:Dzank1 UTSW 2 144488698 missense possibly damaging 0.95
R4516:Dzank1 UTSW 2 144510122 intron probably benign
R4713:Dzank1 UTSW 2 144491804 missense probably benign 0.13
R4782:Dzank1 UTSW 2 144504399 missense probably damaging 1.00
R4994:Dzank1 UTSW 2 144522566 missense probably damaging 1.00
R5514:Dzank1 UTSW 2 144481685 missense probably benign 0.01
R5580:Dzank1 UTSW 2 144506178 missense probably damaging 1.00
R5635:Dzank1 UTSW 2 144483407 missense probably damaging 1.00
R5793:Dzank1 UTSW 2 144506224 missense probably benign 0.14
R5820:Dzank1 UTSW 2 144513488 missense probably damaging 1.00
R5976:Dzank1 UTSW 2 144501489 missense probably damaging 1.00
R6935:Dzank1 UTSW 2 144476094 missense possibly damaging 0.64
R6980:Dzank1 UTSW 2 144490136 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CCAGGTTTCCTACTGTTTGAAAC -3'
(R):5'- AAAGTGATGTCTTAGCCATGCG -3'

Sequencing Primer
(F):5'- AGGTTTCCTACTGTTTGAAACTTTCC -3'
(R):5'- CCATGCGTTTGACTGAAGGAAGTC -3'
Posted On2016-06-21