Incidental Mutation 'R5157:Elmo2'
ID396766
Institutional Source Beutler Lab
Gene Symbol Elmo2
Ensembl Gene ENSMUSG00000017670
Gene Nameengulfment and cell motility 2
SynonymsCED-12, 1190002F24Rik
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R5157 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location165288031-165326479 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 165291707 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017808] [ENSMUST00000071699] [ENSMUST00000074046] [ENSMUST00000094329] [ENSMUST00000103088] [ENSMUST00000103091] [ENSMUST00000109298] [ENSMUST00000109299] [ENSMUST00000109300] [ENSMUST00000130393] [ENSMUST00000131409] [ENSMUST00000132270] [ENSMUST00000133961] [ENSMUST00000156134]
Predicted Effect probably benign
Transcript: ENSMUST00000017808
SMART Domains Protein: ENSMUSP00000017808
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:UAA 15 320 3.5e-10 PFAM
Pfam:TPT 165 315 6.9e-37 PFAM
low complexity region 339 356 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000071699
AA Change: D787V
SMART Domains Protein: ENSMUSP00000071619
Gene: ENSMUSG00000017670
AA Change: D787V

DomainStartEndE-ValueType
Pfam:DUF3361 115 272 1.6e-61 PFAM
Pfam:ELMO_CED12 295 474 3.2e-39 PFAM
Pfam:PH_12 541 657 5.4e-33 PFAM
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000074046
SMART Domains Protein: ENSMUSP00000073691
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 285 2.7e-75 PFAM
Pfam:ELMO_CED12 304 487 3.7e-48 PFAM
PDB:3A98|D 535 729 3e-99 PDB
SCOP:d1mai__ 552 677 4e-33 SMART
Blast:PH 560 681 2e-82 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000094329
SMART Domains Protein: ENSMUSP00000091887
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000103088
AA Change: D787V
SMART Domains Protein: ENSMUSP00000099377
Gene: ENSMUSG00000017670
AA Change: D787V

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 6.6e-77 PFAM
Pfam:ELMO_CED12 292 475 4.3e-48 PFAM
internal_repeat_1 654 672 6.69e-7 PROSPERO
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103091
SMART Domains Protein: ENSMUSP00000099380
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109298
SMART Domains Protein: ENSMUSP00000104921
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:UAA 15 320 3.5e-10 PFAM
Pfam:TPT 165 315 6.9e-37 PFAM
low complexity region 339 356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109299
SMART Domains Protein: ENSMUSP00000104922
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:UAA 15 320 3.5e-10 PFAM
Pfam:TPT 165 315 6.9e-37 PFAM
low complexity region 339 356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109300
SMART Domains Protein: ENSMUSP00000104923
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:TPT 15 314 2.7e-27 PFAM
Pfam:EamA 164 315 1.6e-8 PFAM
low complexity region 339 356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130393
SMART Domains Protein: ENSMUSP00000123450
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131409
SMART Domains Protein: ENSMUSP00000120036
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132270
SMART Domains Protein: ENSMUSP00000125708
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133961
SMART Domains Protein: ENSMUSP00000118227
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:UAA 15 188 9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147247
Predicted Effect probably benign
Transcript: ENSMUST00000148643
SMART Domains Protein: ENSMUSP00000117124
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:ELMO_CED12 2 48 9.6e-10 PFAM
Pfam:PH_12 115 237 1.3e-35 PFAM
low complexity region 270 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156134
SMART Domains Protein: ENSMUSP00000116288
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:UAA 15 188 9e-9 PFAM
Meta Mutation Damage Score 0.1008 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the dedicator of cyto-kinesis 1 protein. Similarity to a C. elegans protein suggests that this protein may function in phagocytosis of apoptotic cells and in cell migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Elmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Elmo2 APN 2 165292014 unclassified probably benign
IGL01096:Elmo2 APN 2 165296987 unclassified probably benign
IGL01694:Elmo2 APN 2 165314773 missense probably benign 0.05
IGL02016:Elmo2 APN 2 165295012 critical splice donor site probably null
IGL02402:Elmo2 APN 2 165297392 missense probably damaging 0.97
IGL02808:Elmo2 APN 2 165291707 unclassified probably benign
IGL03030:Elmo2 APN 2 165294317 missense possibly damaging 0.93
IGL03117:Elmo2 APN 2 165298653 missense probably benign 0.01
R0046:Elmo2 UTSW 2 165298726 missense probably damaging 0.97
R0046:Elmo2 UTSW 2 165298726 missense probably damaging 0.97
R0278:Elmo2 UTSW 2 165297367 missense probably damaging 1.00
R0281:Elmo2 UTSW 2 165296890 missense probably damaging 1.00
R0472:Elmo2 UTSW 2 165298330 missense probably damaging 0.99
R0570:Elmo2 UTSW 2 165304919 missense probably benign 0.38
R1799:Elmo2 UTSW 2 165292157 missense probably damaging 1.00
R1940:Elmo2 UTSW 2 165292050 unclassified probably benign
R2005:Elmo2 UTSW 2 165298279 missense probably benign 0.00
R2504:Elmo2 UTSW 2 165298687 missense probably damaging 0.96
R2915:Elmo2 UTSW 2 165297653 unclassified probably benign
R3744:Elmo2 UTSW 2 165316002 missense probably damaging 0.96
R4027:Elmo2 UTSW 2 165294249 nonsense probably null
R4419:Elmo2 UTSW 2 165311755 unclassified probably null
R4824:Elmo2 UTSW 2 165292002 unclassified probably benign
R4888:Elmo2 UTSW 2 165295289 missense probably benign 0.14
R4950:Elmo2 UTSW 2 165314813 unclassified probably null
R5535:Elmo2 UTSW 2 165310212 missense possibly damaging 0.51
R5682:Elmo2 UTSW 2 165297410 missense probably damaging 1.00
R5840:Elmo2 UTSW 2 165295552 missense possibly damaging 0.64
R5868:Elmo2 UTSW 2 165294272 missense possibly damaging 0.89
R7022:Elmo2 UTSW 2 165295041 missense probably damaging 0.99
R7089:Elmo2 UTSW 2 165304929 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGGCTCCCAGAATGCACATG -3'
(R):5'- TGGATCGCTAAGTCTTTGGACC -3'

Sequencing Primer
(F):5'- GGCTCCCAGAATGCACATGTATTG -3'
(R):5'- TTCTACCACTGGGCTGGACTG -3'
Posted On2016-06-21